BIOLOGY:CONCEPTS+INVEST.-CONNECT ACCESS
5th Edition
ISBN: 9781260542233
Author: Hoefnagels
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 10, Problem 3MCQ
Summary Introduction
Introduction:
Gregor Johann Mendel defines the law of dominance. According to this law, the cross of parents that contain contrasting traits, only one of the trait (dominant trait) will expressed in the next generation (offspring). The offspring will receive the hybrid trait (heterozygous) that contributes in the expression of dominant trait.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 10 Solutions
BIOLOGY:CONCEPTS+INVEST.-CONNECT ACCESS
Ch. 10.1 - Describe the relationships among chromosomes, DNA,...Ch. 10.1 - Prob. 2MCCh. 10.2 - Why did Gregor Mendel choose pea plants as his...Ch. 10.2 - Distinguish between dominant and recessive;...Ch. 10.2 - Prob. 3MCCh. 10.3 - What is a monohybrid cross, and what are the...Ch. 10.3 - How are Punnett squares helpful in following...Ch. 10.3 - Prob. 3MCCh. 10.3 - How does the law of segregation reflect the events...Ch. 10.4 - Prob. 1MC
Ch. 10.4 - Prob. 2MCCh. 10.4 - How can the product rule be used to predict the...Ch. 10.5 - How do patterns of inheritance differ for unlinked...Ch. 10.5 - What is the difference between recombinant and...Ch. 10.5 - Prob. 3MCCh. 10.6 - Prob. 1MCCh. 10.6 - Differentiate between pleiotropy and epistasis.Ch. 10.6 - How can the same phenotype stem from many...Ch. 10.6 - Figures 10.18 and 10.20 show two ways that a...Ch. 10.7 - Prob. 1MCCh. 10.7 - Prob. 2MCCh. 10.7 - Why do males and females express recessive...Ch. 10.7 - Prob. 4MCCh. 10.8 - Prob. 1MCCh. 10.8 - Prob. 2MCCh. 10.9 - Prob. 1MCCh. 10.9 - Prob. 2MCCh. 10.10 - Prob. 1MCCh. 10.10 - Prob. 2MCCh. 10 - In the list of four terms below, which term is the...Ch. 10 - According to Mendel, if an individual is...Ch. 10 - Prob. 3MCQCh. 10 - Which of the following is a possible gamete for an...Ch. 10 - Use the product rule to determine the chance of...Ch. 10 - Refer to the linkage map in figure 10.16b. A...Ch. 10 - How can epistasis decrease the number of...Ch. 10 - Prob. 8MCQCh. 10 - Prob. 9MCQCh. 10 - Prob. 1WIOCh. 10 - Prob. 2WIOCh. 10 - Some people compare a homologous pair of...Ch. 10 - How did Mendel use evidence from monohybrid and...Ch. 10 - Prob. 5WIOCh. 10 - Prob. 6WIOCh. 10 - Prob. 7WIOCh. 10 - Prob. 8WIOCh. 10 - Prob. 9WIOCh. 10 - A family has an X-linked dominant form of...Ch. 10 - X inactivation explains the large color patches in...Ch. 10 - Prob. 12WIOCh. 10 - Prob. 13WIOCh. 10 - Design an experiment using twins to determine the...Ch. 10 - Prob. 1GPCh. 10 - In Mexican hairless dogs, a dominant allele...Ch. 10 - A species of ornamental fish comes in two colors;...Ch. 10 - Two lizards have green skin and large dewlaps...Ch. 10 - Prob. 5GPCh. 10 - Prob. 6GPCh. 10 - Prob. 7GPCh. 10 - Prob. 8GPCh. 10 - Prob. 9GPCh. 10 - Prob. 1PITCh. 10 - Explain the effects of a mutation, using allele,...Ch. 10 - 3. Add meiosis, gametes, incomplete dominance,...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning