
Concept explainers
A1.
To calculate: The number of different fragments obtained if the human genomic DNA having 3×109
Introduction: Bacterial DNA was observed to degrade the foreign DNA present in them always. It leads to the discovery of the restriction enzymes or the restriction nucleases. Restriction nucleases are a novel class of bacterial enzymes that cleave DNA at specific sequences of nucleotides. This property was exploited by the biologists in molecular biology and
A2.
To calculate: The number of different fragments obtained if the human genomic DNA having 3×109 nucleotide pairs per haploid genome is cleaved using the restriction enzyme EcoR I.
Introduction: Bacterial DNA was observed to degrade the foreign DNA present in them always. It leads to the discovery of the restriction enzymes or the restriction nucleases. Restriction nucleases are a novel class of bacterial enzymes that cleave DNA at specific sequences of nucleotides. This property was exploited by the biologists in molecular biology and biotechnology to generate DNA fragments of different sizes using different restriction enzymes with known end sequences at the site of cleavage. One to more restriction enzymes are used to obtain DNA fragments of varying length.
B.
To explain: The possible reason for using Hae III to cleave human DNA for human genomic libraries though they do partial digestion of DNA.
Introduction: Bacterial DNA was observed to degrade the foreign DNA present in them always. It leads to the discovery of the restriction enzymes or the restriction nucleases. Restriction nucleases are a novel class of bacterial enzymes that cleave DNA at specific sequences of nucleotides. This property was exploited by the biologists in molecular biology and biotechnology to generate DNA fragments of different sizes using different restriction enzymes with known end sequences at the site of cleavage. One to more restriction enzymes are used to obtain DNA fragments of varying length.

Want to see the full answer?
Check out a sample textbook solution
Chapter 10 Solutions
Essential Cell Biology (fifth Edition)
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





