Microbiology: A Systems Approach
4th Edition
ISBN: 9780073402437
Author: Marjorie Kelly Cowan Professor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 1, Problem 9MCQ
Order the following items by size, using numbers: 1 = smallest through 8 = largest.
___ adenovirus
___ amoeba
___ rickettsia
___ protein
___ helminths
___ coccus-shaped bacterium
___ white blood cell
___ atom
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Order the following items by size, using numbers: 1 = smallest and8 = largest.human immunodeficiency virus HIV________________protozoan
________________rickettsia________________protein________________worm________________coccus-shaped bacterium________________spirochete________________atom
https://www.youtube.com/watch?v=3ivMSCi-Y2Q&feature=emb_logo
https://www.youtube.com/watch?v=q2nWNZ-gixI&feature=emb_logo
what do bobtail squids and bacteria have in common? How can this knowledge be applied to the medical field?
can you please help me with the table at the end of the paper? By the way, do you know if all the questions that I asked is gonna go public if someone ever look it up? thank you so much :)
Chapter 1 Solutions
Microbiology: A Systems Approach
Ch. 1.1 - List the various types of microorganisms.Ch. 1.1 - Identify multiple professions using microbiology.Ch. 1.2 - Describe the role and impact of microbes on the...Ch. 1.2 - Explain the theory of evolution and why it is...Ch. 1.3 - Explain one old way and one new way that humans...Ch. 1.4 - Summarize the relative burden of human disease...Ch. 1.5 - Differentiate among bacteria, archaea, and...Ch. 1.5 - Identify a fourth type of microorganism.Ch. 1.5 - Compare and contrast the relative sizes of the...Ch. 1.6 - Make a time line of the development of...
Ch. 1.6 - Prob. 2CFCh. 1.6 - List some recent microbiological discoveries of...Ch. 1.6 - Explain what is important about the scientific...Ch. 1.7 - Differentiate among the terms nomenclature,...Ch. 1.7 - Create a mnemonic device for remembering the...Ch. 1.7 - Correctly write the binomial name for a...Ch. 1.7 - Draw a diagram of the three major domains.Ch. 1.7 - Explain the difference between traditional and...Ch. 1 - Prob. 1CFCh. 1 - Which of the following is not considered a...Ch. 1 - Which process involves the deliberate alteration...Ch. 1 - Prob. 3MCQCh. 1 - Prob. 4MCQCh. 1 - Prob. 5MCQCh. 1 - Prob. 6MCQCh. 1 - Which is the correct order of the taxonomic...Ch. 1 - Prob. 8MCQCh. 1 - Order the following items by size, using numbers:...Ch. 1 - How would you classify a virus? a. prokaryotic b....Ch. 1 - Organisms in the same order are more closely...Ch. 1 - Prob. 12TFCh. 1 - Prob. 13TFCh. 1 - Prob. 14TFCh. 1 - Prob. 15TFCh. 1 - Prob. 1CTQCh. 1 - Define the term ubiquitous, and provide examples...Ch. 1 - Prob. 3CTQCh. 1 - Prob. 4CTQCh. 1 - Prob. 5CTQCh. 1 - Prob. 6CTQCh. 1 - Differentiate the terms emerging disease and...Ch. 1 - Discuss how the findings of Louis Pasteur may have...Ch. 1 - Prob. 9CTQCh. 1 - You are a scientist researching West Nile virus, a...Ch. 1 - Prob. 1CCCh. 1 - Prob. 2CCCh. 1 - Prob. 3CCCh. 1 - Prob. 1VCCh. 1 - Prob. 1CM
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The term _________________________________ means pertaining to a virus. viral virilearrow_forwardImagine that a NEW extremely contagious and deadly disease has swept the Earth. What would society in the aftermath look like? Keep it simple and easy. Write 2 paragraphsarrow_forwardBacillus and Clostridium both form ___________________. These resistant structures are found in the dirt and are important for transmission of these microbes. Give a specific explanation of how each of these microbes normally moves from its reservoir in the dirt to enter a host. Anthrax (Hint: Anthrax is sometimes known as “wool-sorter’s” disease) Cutaneous Inhalation/ Pulmonary Ingestion/ Gastrointestinal Tetanus Botulismarrow_forward
- Choose the false statement: (Regarding Pasteur’s famous experiment) The swan necked flasks were important because they allowed the broth to remain sterile, while still remaining open to the atmosphere. Pasteur’s work with the swan neck flasks was only of importance to the food industry; his work occurred long before anyone, including Pasteur, had any awareness that diseases could be caused by microscopic agents. The swan necked flasks were used to prove that life could only arise from pre-existing cells.arrow_forwardSelect the organism that matches each description. Some answers may be used more than once, and some not at all. Make sure that you scroll in the selection box, there are 13 possible matches. Was on Romaine lettuce sent from Yuma, AZ causing food-borne diarrhea Forms chains of Gram positive cells and is a common cause of tooth decay. A member of the normal vaginal flora that can overgrow at high pH Protozoan that is resistant to normal levels of chlorine used to disinfect the water Is salt tolerant and can inhabit the skin of healthy individuals, but can cause furunculosis Known as group B streptococci, is beta hemolytic and CAMP test positive Protozoan in stagnant water causing primary amoebic meningitis Psychrotropic, Gram positive rod transmitted in dairy causing systemic disease Escherichia coli O157:H7 Streptococcus pneumoniae Candida albicans Pseudomonas aeruginosa Cryptosporidium parvum Streptococcus mutans Streptococcus agalactiae Staphylococcus aureus Campylobacter jejuni Aarrow_forwardAnswer the questions with answers onlyarrow_forward
- My professor instruct me to make presentation slide on this topic "Tounge". Now we have total 5 members in our group. Can you please divide the topic into 5 sub parts or topic? I will rate you positive if you do so. Please don't use AI for answering this question.arrow_forwardCan you tell me about a malaria pandemic in history, please?arrow_forward18) What tissue samples the above slides were taken from?19) What is the name of the parasite patient 1 is infected with?20) What is the name of the vector for the patient 1 parasite? ** the information is located on the top**arrow_forward
- CAN Corynebacterium diphtheriae be infected by a viruses. I know it is a bacteria but I need to know if it is possible for it to be infected by a virus. Please be specific but in terms that is easy to understand. PLEASE answer this specif question. I don't need to know the causes, effects, outcomes, etc of Corynebacterium diphtheriae. I already know that stuff, I need this specific question answered. THANK YOU.arrow_forwardI completed the chart, and I'm supposed to figure out the unknown bacteria, there are 12 unknown culture, out of which of them resemble my chart the most? (My chart is the one in pink with the information filled out)arrow_forwardYou grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGTarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY