
Microbiology: A Systems Approach
4th Edition
ISBN: 9780073402437
Author: Marjorie Kelly Cowan Professor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Question
Chapter 1, Problem 12TF
Summary Introduction
Introduction:
The prokaryotic cells lack cell organelles, such as chloroplasts and mitochondria, whereas, the eukaryotic cells possess both organelles. The mitochondria are the cellular organelles that provide the cellular energy in the form of ATP (adenosine triphosphate). The chloroplasts are the cellular organelles present in the plant and algal cells that help in the synthesis of the food using sunlight.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?
Chapter 1 Solutions
Microbiology: A Systems Approach
Ch. 1.1 - List the various types of microorganisms.Ch. 1.1 - Identify multiple professions using microbiology.Ch. 1.2 - Describe the role and impact of microbes on the...Ch. 1.2 - Explain the theory of evolution and why it is...Ch. 1.3 - Explain one old way and one new way that humans...Ch. 1.4 - Summarize the relative burden of human disease...Ch. 1.5 - Differentiate among bacteria, archaea, and...Ch. 1.5 - Identify a fourth type of microorganism.Ch. 1.5 - Compare and contrast the relative sizes of the...Ch. 1.6 - Make a time line of the development of...
Ch. 1.6 - Prob. 2CFCh. 1.6 - List some recent microbiological discoveries of...Ch. 1.6 - Explain what is important about the scientific...Ch. 1.7 - Differentiate among the terms nomenclature,...Ch. 1.7 - Create a mnemonic device for remembering the...Ch. 1.7 - Correctly write the binomial name for a...Ch. 1.7 - Draw a diagram of the three major domains.Ch. 1.7 - Explain the difference between traditional and...Ch. 1 - Prob. 1CFCh. 1 - Which of the following is not considered a...Ch. 1 - Which process involves the deliberate alteration...Ch. 1 - Prob. 3MCQCh. 1 - Prob. 4MCQCh. 1 - Prob. 5MCQCh. 1 - Prob. 6MCQCh. 1 - Which is the correct order of the taxonomic...Ch. 1 - Prob. 8MCQCh. 1 - Order the following items by size, using numbers:...Ch. 1 - How would you classify a virus? a. prokaryotic b....Ch. 1 - Organisms in the same order are more closely...Ch. 1 - Prob. 12TFCh. 1 - Prob. 13TFCh. 1 - Prob. 14TFCh. 1 - Prob. 15TFCh. 1 - Prob. 1CTQCh. 1 - Define the term ubiquitous, and provide examples...Ch. 1 - Prob. 3CTQCh. 1 - Prob. 4CTQCh. 1 - Prob. 5CTQCh. 1 - Prob. 6CTQCh. 1 - Differentiate the terms emerging disease and...Ch. 1 - Discuss how the findings of Louis Pasteur may have...Ch. 1 - Prob. 9CTQCh. 1 - You are a scientist researching West Nile virus, a...Ch. 1 - Prob. 1CCCh. 1 - Prob. 2CCCh. 1 - Prob. 3CCCh. 1 - Prob. 1VCCh. 1 - Prob. 1CM
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
- Basic Clinical Lab Competencies for Respiratory C...NursingISBN:9781285244662Author:WhitePublisher:CengageBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning


Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Basic Clinical Lab Competencies for Respiratory C...
Nursing
ISBN:9781285244662
Author:White
Publisher:Cengage

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Prokaryotic vs. Eukaryotic Cells (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=Pxujitlv8wc;License: Standard youtube license