You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGT

Q: The genome of bacteria cells, eukaryotic cells, and viruses are all about the same size. True or…

A: Genomes can be described as the haploid set of chromosomes present in an organism.

Q: Watch the following video called "Human Genome Project Video"…

A: Decoding the human genome has provided a wealth of information that is revolutionizing medicine,…

Q: Synthesize a Protein Below is a region of a gene. Transcribe the gene into a pre-mRNA strand.…

A: The DNA is the genetic material that is passed from one generation to the next generation. It is…

Q: For this activity you will draw out the first steps of the PCR reaction, using the following as a…

A: Introduction  PCR is the revolutionized technique invented by Karry Mullis in 1983, for which he got…

Q: What are the endocannabinoids? How do cannabis and the endocannabinoid system work?

A: Introduction  An organ system is a group of organs that work together to perform a specific function…

Q: Based on these sequences, how do you decide decided which fragments were the beginning, middle, and…

A: There are three fragments given in the question. The three fragments can be aligned on the basis of…

Q: you are given a printout of the sense strand of your DNA.  The printout is shown below. The first…

A: Introduction: DNA is a double helix having a sugar-phosphate backbone like a ladder and the base…

Q: With regards to this sequence below please answer this quistions 1) What is the format of the…

A: answer given below

Q: Transcribe the DNA into mRNA.  Sequence A…

A: The process of synthesis of messenger RNA with the help of DNA template strand is called…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: BOTTOM The sequence depicted on the gel is 5'-GTGATGTAG-3' The sequence depicted on the gel is 3'-…

A: This method is used for DNA sequencing and it relies on the use of Deoxyribonucleoside…

Q: Does this protein absorb light at 280 nm? If yes, please write (as a number) how many residues…

A: Amino acids are organic compounds with functional groups namely carboxyl and amino. Proteins are…

Q: F E D H 1-09 G H life cycle life cycle A C B

A: Virus is a minute entity just like other microbe but have small size.  It has dua nature . It behave…

Q: The gene ABCD is 1500 bases long What would be the likely length of the pre-mRNA molecule? ____ What…

A: INTRODUCTION Exons are coding sections of an RNA transcript, or the DNA encoding it, that are…

Q: A researcher wants to cut this piece of linear DNA. 5 AGCTAGTCCGGATCCGAGGGCCCTTCTCATGAGATCCGGATGACC…

A: The discovery of restriction enzymes in 1968 by Swiss scientist "Werner Arber" ushered in the era of…

Q: How would you write out the sequence for the FORWARD primer if you needed to purchase it for use in…

A: When designing a forward primer for PCR, it is essential to write the sequence in the 5' to 3'…

Q: Use this diagram of a eukaryotic gene to answer the following questions. Pay close attention to the…

A: Introduction Gene expression is the process through which a gene's information is used to create a…

Q: You are asked to sequence a piece of DNA to determine if it is from a gene thought to be involved in…

A: DNA sequencing is an important technique used to determine the sequence of unknown fragments of DNA…

Q: 18. You want to express hemoglobin beta (HBB) in a bacteria model using a vector. You would like to…

A: PCR (Polymerase Chain Reaction) is a laboratory technique used to amplify specific regions of DNA.…

Q: following question is related to Restriction Enzymes and RFLP. Using EcoRl, which DNA sequence held…

A: Restriction enzymes, also known as restriction endonucleases, are a key tool in molecular biology.…

Q: A researcher wants to cut this piece of linear DNA. 5'…

A: The restriction enzymes are the specific enzymes that act on the DNA molecule and perform its…

Q: Below is the sequence of the yeast S cerevisiae GCN4 gene including 100 bp upstream and 100 bp…

A: Introduction to the topic of introns:Introns are non-coding regions of DNA that are transcribed into…

Q: What restriction enzyme (or enzymes) would you use to cut the following...   (Gene of Interest is…

A: Forward Primer:5'-TCTAGAGTCAATGAAACAACA-3'Explanation:This sequence starts with the same…

Q: If a researcher wants to use bacteria to make a eukaryotic protein, she should use a plasmid from:…

A: The recombinant DNA technology involves transfer of foreign DNA into an organism. We used this…

Q: Consider the following four DNA sequences taken from the a homologous gene from four different…

A: Multiple sequence alignment is majorly used to find out evolutionary relationship between…

Q: Transcription and Translation Practice Directions: Read each sequence of DNA and transcribe it to…

A:

Q: How would you write out the sequence for the REVERSE primer if you needed to purchase it for use in…

A: The reason we write the reverse primer sequence in the reverse complement form is to ensure that it…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: Suppose you have to design two PCR primers, 16 bases in length, to amplify the whole of the 100 bp…

A: Primers are short nucleic acid molecule, that are single stranded in nature and area prerequisite…

Q: The following gene sequence of nucleotides is found on the template (non-coding) strand of a…

A: The sequence would be opposite to template strand and similar to coding strand(except the thiamine…

Q: 1 agagtctcct cagacgccga gatgctggtc atggcgcccc gaaccgtcct cctgctgctc 61 tcggcggccc tggccctgac…

A: Annotating a genome involves finding functional components throughout its sequence in order to give…

Q: The following are DNA sequences from two homologous genes:…

A: Homology is an idea of finding evolutionary lineage. Homology is deduced when two Deoxyribose…

Q: quizzes/85114/take WebSTAC Dashboard Workday Help | Wa... Home - Workday b Identify the W Second…

A: DNA complementary-CCG ATC TGA GTA TAG CCC  mRNA- GGC UAG ACU CAU AUC GGG

Q: The following sequence is from a region of the M13 bacteriophage genome. Identify and label the…

A: Viruses do not have a living cell like other organisms. They have genetic material encapsulated…

Q: The following question is related to Restriction Enzymes and RFLP. Using EcoRl, how many fragments…

A: Restriction enzymes are enzymes that cleave DNA. Each enzyme identifies and chops DNA at or near one…

Q: Using the data in Table, identify restriction enzymes that (a) produce blunt ends; (b) recognize and…

A: Restriction enzymes or restriction endonucleases is a protein produced by the bacteria which has the…

Q: Below is a set of sequence reads from an individual aligned to a reference sequence. AGACACTCCACC…

A: Homozygous SNPs - has multiple possible alleles - 1 Heterozygous SNPs - has specific insertions or…

Q: TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT Compare this mutated sense…

A: ORIGINAL:- TGAGGATGAAACTCACACCGGGGCGCAAGTTTGGCACTTAGATTCTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT…

Q: Based on these sequences. Remove codons 24 to 66, inclusive. Sequence A…

A: The enzyme complex responsible for this excision is known as splicesome. Splicesomes are complicated…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.