Microbiology with Diseases by Body System (5th Edition)
5th Edition
ISBN: 9780134477206
Author: Robert W. Bauman Ph.D.
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 1, Problem 1CM
Using the following terms, fill in the following concept map that describes what microbiologists study. You can also complete this and other concept maps online by going to the MasteringMicrobiology Study Area.
Acellular
Algae
Animal-like
Archaea
Bacteria
Eukaryotes
Molds
Multicellular
Obligate intracellular
Protozoa
Unicellular
Yeasts
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A professional microbiologist is least likely to study which of the following organisms?
A large bacterium like Epulopiscium fishelsoni that is visible to the naked eye
A small single-celled eukaryote like Plasmodium falciparum
Pyrococcus furiosus, an extremophilic Archaeon
Human egg and sperm cells
You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below:
>UnknownSequence1
GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC
GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGT
Select the organism that matches each description. Some answers may be used more than once, and some not at all. Make sure that
you scroll in the selection box, there are 13 possible matches.
Was on Romaine lettuce sent from Yuma, AZ
causing food-borne diarrhea
Forms chains of Gram positive cells and is a
common cause of tooth decay.
A member of the normal vaginal flora that can
overgrow at high pH
Protozoan that is resistant to normal levels of
chlorine used to disinfect the water
Is salt tolerant and can inhabit the skin of healthy
individuals, but can cause furunculosis
Known as group B streptococci, is beta hemolytic
and CAMP test positive
Protozoan in stagnant water causing primary
amoebic meningitis
Psychrotropic, Gram positive rod transmitted in
dairy causing systemic disease
Escherichia coli O157:H7
Streptococcus pneumoniae
Candida albicans
Pseudomonas aeruginosa
Cryptosporidium parvum
Streptococcus mutans
Streptococcus agalactiae
Staphylococcus aureus
Campylobacter jejuni
A
Chapter 1 Solutions
Microbiology with Diseases by Body System (5th Edition)
Ch. 1 - Some people consider Leeuwenhoek the Father of...Ch. 1 - Prob. 1CCSCh. 1 - Some people consider Pasteur or Koch to be the...Ch. 1 - Variant Creutzfeldt-Jakob Disease Ellen screamed...Ch. 1 - Prob. 3TMWCh. 1 - Which of the following microorganisms are not...Ch. 1 - Prob. 2MCCh. 1 - In which habitat would you most likely find...Ch. 1 - Of the following scientists, who first promulgated...Ch. 1 - Which of the following scientists hypothesized...
Ch. 1 - Prob. 6MCCh. 1 - Prob. 7MCCh. 1 - Prob. 8MCCh. 1 - A scientist who studies the role of microorganisms...Ch. 1 - The laboratory of Robert Koch contributed which of...Ch. 1 - Fill in the Blanks 1. Environmental microbiology...Ch. 1 - Prob. 2FIBCh. 1 - Fill in the Blanks 3. Chemotherapy _______________Ch. 1 - Fill in the Blanks 4. Immunology _______________Ch. 1 - Fill in the Blanks 5. Infection control...Ch. 1 - Fill in the Blanks 6. Etiology _______________Ch. 1 - Fill in the Blanks 7. Epidemiology _______________Ch. 1 - Fill in the Blanks 8. Biotechnology...Ch. 1 - Fill in the Blanks 9. Food microbiology...Ch. 1 - Why was the theory of spontaneous generation a...Ch. 1 - Discuss the significant difference between the...Ch. 1 - List six types of microorganisms.Ch. 1 - Defend this statement: The investigations of...Ch. 1 - Why would a macroscopic tapeworm be studied in...Ch. 1 - Describe what has been called the Golden Age of...Ch. 1 - List four major questions that drive...Ch. 1 - Refer to the four steps in the scientific method...Ch. 1 - Prob. 9SACh. 1 - What does the term HAI (nosocomial infection) have...Ch. 1 - Match each of the following descriptions with the...Ch. 1 - Prob. 1VICh. 1 - Show where microbes ended up in Pasteurs...Ch. 1 - If Robert Koch had become interested in a viral...Ch. 1 - In 1911, the Polish scientist Casimir Funk...Ch. 1 - Haemophilus influenzae does not cause flu, but it...Ch. 1 - Just before winter break in early December, your...Ch. 1 - Design an experiment to prove that microbes do not...Ch. 1 - Prob. 6CTCh. 1 - Compare and contrast the investigations of Redi,...Ch. 1 - If you were a career counselor directing a student...Ch. 1 - A few bacteria produce disease because they derive...Ch. 1 - How might the debate over spontaneous generation...Ch. 1 - French microbiologists, led by Pasteur, tried to...Ch. 1 - Why arent Kochs postulates always useful in...Ch. 1 - Albert Kluyver said, From elephant to ......Ch. 1 - The ability of farmers around the world to produce...Ch. 1 - Using the following terms, fill in the following...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- create your own drawing that provides the types of microorganisms within each category and compares the size of cellular and acellular microorganisms. You must include two microorganisms per category - your submission must demonstrate your understanding of how the sizes and structure of these microorganisms help to classify them as cellular or acellular by adding a brief statement at the bottom of the drawing describing cellular vs acellular please help!arrow_forwardGive detailed Solution (no need Handwritten)arrow_forwardgo to the website https://www.nature.com/immersive/d42859-019-00041-z/index.html and scroll up and down to review the milestones associated with microbiota research. Answer the questions/ prompts below. Bacteria and our brain? Read the information associated with this milestone and what was discovered. Briefly describe what they found...Milestone/year? What milestone is associated with the debate about when the microbiome is first established? Why is there a debate? Watch the video just below the milestone. What specific type of gene analysis was used to determine that we have our own unique microbiome? Which milestone/year? Sometimes we need antibiotics...this milestone discusses how long it can affect us after infection. In this milestone they discussed how long we could be affected by one course of antibiotics...how long? Which milestone/year? Find the milestone associated with a highly motile bacteria. What disease was treated? How was this treatment used for a…arrow_forward
- Which of these organisms are made up of a single cell? Please choose the correct answer from the following choices, and then select the submit answer button. Answer choices plants fungi cyanobacteria virusarrow_forwardexpress some basic evolutionary relationships among groups of microorganisms i need other answers please explain well do not copy from others or i will downvotearrow_forwardPlease help,arrow_forward
- Instructions: Create a concept mapping in the Historical Development of Microbiology and write a brief explanation about it. DO NOT COPY CONCEPT MAP ON THE INTERNET I WILL GIVE BAD FEEDBACK asaparrow_forwardPlease use the following terms or set of terms to complete the paragraph. Some terms may be used once, more than once or not at allarrow_forwardName at least 5 Medical Microbiology concepts in your own/your family’s life and in your particular community’s situation.arrow_forward
- https://www.youtube.com/watch?v=3ivMSCi-Y2Q&feature=emb_logo https://www.youtube.com/watch?v=q2nWNZ-gixI&feature=emb_logo what do bobtail squids and bacteria have in common? How can this knowledge be applied to the medical field?arrow_forwardWhich of the following features does not accurately describe Giardia lamblia? Question options: infectious all of these eatures accurately describe Giardia lamblia protozoan prokaryotic flagellated fecal-oral transmissionarrow_forwardConstruct your own concept map using the following words as the concepts. Supply the linking words between each pair of concepts. (Make one concept map for prokaryotic microbes and another for eukaryotic microbes) PROKARYOTIC MICROBES: genus species serotype domain Borrelia burgdorferi spirochete EUKARYOTIC MICROBES: Golgi apparatus chloroplasts cytoplasm endospore ribosomes flagella nucleolusarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Parasites: Protozoa (classification, structure, life cycle); Author: ATP;https://www.youtube.com/watch?v=V4iSB0_7opM;License: Standard youtube license