Zoin о Continued to Page DATE

Q: 9. A) Please write down the names of the following protein folds. A B C B) Which one(s) is made of…

A: C) Haemoglobin the motif is coiled structure which facilitates binding of four polypeptide chains,…

Q: I have glucoseoxidase 1000 Udl-1. What is the exact unit of the enzyme that could work for 1…

A: Specific activity of glucose oxidase  (from literature)  : 200 units/mg protein  Calculation: First,…

Q: DRAW ON PAPER PLEASE - Amylose is a linear polymer of several thousand glucose units linked by (14)…

A: Amylose is a polysaccharide. It is made up of -D-glucose residues linked via (14) glycosidic linkage…

Q: QUESTION 5 Carbohydrates supply which element for the construction of other biomolecules? carbon…

A: Carbohydrates supply the element carbon for the construction of other biomolecules. Carbon is a…

Q: Identify the product of the given reaction. IV I II III heat ? = III IV

A: Option (d) III is correct See solution in image  Explanation:

Q: In bacteria, what is the role of the Shine-Dalgarno sequence?   Question 3 options:   It binds to…

A: The Shine-Dalgarno sequenceRibosomal binding site in mRNA.It enables initiation of protein synthesis…

Q: 1. Rank the following amines from lowest to highest boiling point. Explain your reasoning. CH3…

A: Answer 1correct order is B< A< CExplanation:Step 1: Step 2: Step 3: Step 4:

Q: 11. Quantitative Relationships between Rate Constants to Calculate K, Kinetic Efficiency (kcat/Km)…

A: Kinetic parameters are Km and  Vmax. They are used to determine the efficiency of an enzyme. Km is…

Q: 2. The diagram to the right shows the change in the structure of the C-terminal portion of each of…

A: Therefore, the final answer is: (a) Without the His146 residue, CPA-treated hemoglobin would have a…

Q: Give 2 differences between the lagging strand and the leading strand

A: DNA replication is the process by which the double stranded DNA (dsDNA) molecules are copied to…

Q: Calculcate Kcat for PNP substrate for both enzyme concentrations.  enzyme volume: 20 ul  Bovine…

A: To calculate the turnover number (Kcat) for the alkaline phosphatase enzyme using p-Nitrophenyl…

Q: B-oxidation deals with only saturated fatty acids, but many fatty acids in natural lipids are…

A: Beta oxidation is a metabolic process in which the two carbon atoms are sequentially removed from…

Q: 7. Why proteins prefer to have a-helices or ẞ-sheets in their interior core, instead of random coil…

A: The preference for alpha helices and beta sheets in the interior core of proteins is driven by a…

Q: Which of the following statements is most accurate ? All statements are accurate All prescribed…

A: The objective of the question is to identify the most accurate statement among the given options…

Q: Classify each of the amino acids below. Note for advanced students: none of these amino acids are…

A: Certainly! Amino acids, the building blocks of proteins, are typically classified by the properties…

Q: STEM Workplace Practices Q7

A: The objective of the question is to identify the primary responsibilities that are routinely…

Q: A drawing of a cell in G2 interphase is provided. The cell contains 4 replicated chromosomes with…

A: A cell in G2 interphase is a stage in the cell cycle where the cell has completed the S (synthesis)…

Q: Experiment Mouse injected with type S Mouse injected with type R Lived or Died Die Live Mouse…

A: In 1928, Frederich Griffith undertook the bacterial transformation experiment where he injected mice…

Q: sickle cell anemia

A: Sickle cell anemia (SCA) is a genetic disorder identified by abnormal red blood cells. Genetic…

Q: 1. Draw the Fisher projection of D-glucose, and from Fisher to Haworth projection of ẞ-D-glucose.…

A: The configurations of the D-glucose are: R , S , R , RIn β−D−glucose C1 -OH is present on the up…

Q: 14. A protein mixture consisting of proteins A, B, and C was subjected to various protein…

A: The objective of the question is to determine the properties of proteins A, B, and C based on their…

Q: 11. (ME.23) Given the pathway below, steps catalyzed by enzymes are good candidates for regulation…

A: Enzymes are high molecular weight protein compounds, exceptions are ribozymes. Enzymes are…

Q: What is the major organic product obtained from the following reaction? OH OH OH OH 1. NaOH, H₂O 2.…

A:

Q: 18. Name a currently unsolved problem in any of the areas we've covered so far, [pentose phosphate…

A: In the domain of plant engineering, an ongoing challenge revolves around creating crops capable of…

Q: 5'-AATGCCTCAGCCGATCTGCCTCGAGTCAATCGA TGCTGGTAACTTGGGGTATAAAGCTTACCCATGGTATCGTAG…

A: PCR is a lab technique used for amplification of target DNA sequence by using a thermostable DNA…

Q: (a). The product of the reaction has two chiral centers as shown: The Ca atom of the amino acid…

A: To determine the L/D configuration of amino acids, place the alpha carbon () in the center, the…

Q: A 70-year-old woman visited her GP complaining of a sore throat, a fever (38.5°C),  and recent loss…

A: the patients symptoms and elevated liver enzymes ,alongside positive IgM antibodies for Epstein-Barr…

Q: Number of reactions/steps that are highly regulated during glycolysis is/are __ ☐ 3 ☐ 10 ○ 1 4

A: Multiple steps in glycolysis are highly regulated to ensure the efficient control of the pathway.…

Q: Question 12 In the tertiary structure of a protein, the R-group of valine can interact with the…

A: Proteins are bio molecules with vast diversity in their structure. They exhibit four levels of…

Q: Transcription factors are a specific type of nuclear proteins. How do transcription factors get…

A: Transcription factors are proteins that bind to the specific DNA sequences in or around the…

Q: 4) Following is the structural formula of lycopene, a deep red compound that is partially…

A: ● Lycopene is a naturally occurring pigment belonging to the carotenoid family which is…

Q: What is the mRNA transcribed by the following piece of DNA? Make sure to label its directionality.…

A: To determine the mRNA transcribed from the given DNA sequence, We need to identify the complementary…

Q: A glucose molecule with its 3rd carbon radiolabelled underwent glycolysis. Which carbon atom in the…

A: During the process of glycolysis, glucose is broken down into pyruvate and energy, producing two…

Q: The following table provides data on three popular protein supplements. (Figures shown correspond to…

A: Let the number of servings of designer whey be 'x' and the number of servings of muscle milk be…

Q: In the same kinetics experiment above without the inhibitor, what is the fraction of occupied enzyme…

A: Michaelis Menton equationFor a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton…

Q: 4. The interaction of Vitamin D3 with lipid membranes may be studied using different techniques. One…

A: A class of fat-soluble secosteroids is called vitamin D3 .Vitamin D3 is a kind of vitamin D that is…

Q: 1.(a) ( ) Trace the course of [1,6-(C-14)-2,5-(C-13)]glucose that is first processed through…

A: Explanation of [1,6-(C-14)-2,5-(C-13)] glucose BreakdownThis explanation accompanies the answer,…

Q: 12. Consider a protein that can exist in two forms: folded (F) and unfolded (UF). Calculate the free…

A: (i.) ΔGunfolding = 2100.30 J/mol  or approximately  2.10 kJ/mol (ii.) ΔGunfolding =  -5446.52 J/mol…

Q: What is the concentration in ppm of Sulphur in a water supply if there are 0.002mL of Sulphur in…

A: Step 1:We need to use the conversion 1ppm= 0.001mL/LBased on the given,Since we have 0.002mL/L…

Q: Which of the following has the compounds shown in the correct order of decreasing acidity (i.e.,…

A: Step 1: • Let's understand step by step: 1) Acidic Behavior: A compound is considered acidic if it…

Q: 13. The structures of sphingosine and choline are given below. Draw the condensed structure and…

A: Sphingolipids has sphingosine as its platform molecule. Onto this sphingosine, a head group and a…

Q: 1. draw the structures (linear and cyclical) of the common carbohydrates. 2. draw the structure of…

A: All living organisms contain microscopic building components called biomolecules.These compounds…

Q: 16. A quantitative study of the interaction of a protein with its ligand yielded the following…

A: I cannot plot the graph as that would be doing your homework.Determine KD:From the graph, read the…

Q: 6. Discuss the potential contributions of ionic interaction, hydrogen bonds, hydrophobic…

A: Aspartic acid (Asp) contributes to ionic and hydrogen bonds, while hydrophobic and Van der Waals…

Q: Can you help with q3 please, thank you.

A: The intermolecular interactions for the given active site of RNA is listed below . Explanation:Step…

Q: 4. Gentiobiose (D-Glc(ẞ1-6)D-glc) is a disaccharide found in some plant glycosides. Draw Haworth…

A: Gentiobiose has a beta-glycoside link, originating at C-1 in ring A and terminating at C-6 in ring…

Q: Draw the major organic product obtained form the following sequence of reactions (assume that…

A:

Q: What is the effect of each of the 4 types of inhibitors on the initial rate of an enzyme catalyzed…

A: Inhibitors of enzyme catalyzed reactions are broadly classified into reversible and irreversible…

Q: None

A: To correctly match the terms with their appropriate properties, we need to examine each term and…

Q: How does a protein 'know' how to fold into its native conformation and in general why is folding…

A: Proteins are made up of amino acids, which are linked together in a specific sequence by peptide…