### DNA Fragment Sticky End Exercise**Objective:** Understand the generation of sticky ends in DNA after BsaI digestion.**Problem Statement:**Below is a description of a double-stranded DNA sequence. After digestion with the BsaI enzyme, this DNA fragment will have sticky ends as shown in the diagram:- **5’ GTAG** sticky end on the left- **5’ CAGC** sticky end on the right**Task:**Replace the “N” bases in the provided sequence with specific double-stranded sequences. These sequences should ensure the correct sticky ends are formed post BsaI digestion. Include the BsaI recognition sequence and sticky end sequences in your answer.**Example DNA Sequence with Sticky Ends:**- **5’ End:** - Original: `5’ GTAG` - Sticky end planned: `5’ CAGC`- **Sequence Template:** ``` 5’ - NNNNNNNNNNNNNNNN ... NNNNNNNNNNNNNNNN - 3’ 3’ - NNNNNNNNNNNNNNNN ... NNNNNNNNNNNNNNNN - 5’ ```**Instructions:**1. Identify the BsaI recognition sequences in your lab manual.2. Modify the “N” bases to incorporate these sequences, ensuring the correct formation of the sticky ends: - **Left:** Add nucleotides to create the 5’ GTAG sticky end. - **Right:** Add nucleotides to create the 5’ CAGC sticky end.Feel free to either remove or include extra “N” bases as needed for clarity.### Diagram Explanation:The diagram shows the DNA orientation and the expected sticky ends resulting from BsaI enzyme digestion. You start with sequences labeled as "N" bases, and your goal is to modify them according to the given task, ensuring proper sticky ends are achieved.

Introduction :- DNA strands are digested with the help of various restriction enzymes .Bsal is an…

ЗА. This DNA after Bsal digestion, produces a DNA fragment with sticky ends as shown in the figure to the right. That is, the fragment has: Below is shown a double stranded DNA with some bases labeled as N's. 5- GTAG CGAC - 5 - a 5' GTAG sticky end on the left - a 5' CAGC sticky end on the right. Replace the N's below with the specific double stranded sequences that would need to be present on each end to obtain the desired sticky ends after Bsal digestion. Include Bsal and sticky end sequences in your answer. The recognition sequence for Bsal is in the lab manual. There are more "N" bases shown below than are needed. You can remove the extra ones or just leave them. 5- NNNNNNNNNNNNNNN NNNNNNNNNNNNNNN - 3' | 3-ΝNN NNN NNNNΝN NNNNNΝΝNNNNΝNN -5

ЗА. This DNA after Bsal digestion, produces a DNA fragment with sticky ends as shown in the figure to the right. That is, the fragment has: Below is shown a double stranded DNA with some bases labeled as N's. 5- GTAG CGAC - 5 - a 5' GTAG sticky end on the left - a 5' CAGC sticky end on the right. Replace the N's below with the specific double stranded sequences that would need to be present on each end to obtain the desired sticky ends after Bsal digestion. Include Bsal and sticky end sequences in your answer. The recognition sequence for Bsal is in the lab manual. There are more "N" bases shown below than are needed. You can remove the extra ones or just leave them. 5- NNNNNNNNNNNNNNN NNNNNNNNNNNNNNN - 3' | 3-ΝNN NNN NNNNΝN NNNNNΝΝNNNNΝNN -5

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Q: Restriction digestion and Gel electrophoresis: A single strand of a double-stranded DNA sequence is…

A: Restriction digestion is a process in which DNA is cut into smaller pieces at specific sites with…

Q: Pick a plasmid . What was its approximate transformation? Express it in # colonies per microgram of…

A: Transformation is the ability of a bacterial cell to pick up naked DNA from the environment.

Q: Fill in the gaps in the paragraphs below: Blood pressure can be regulated by the nervous system, in…

A: The two parts of the autonomic nervous system are- sympathetic and parasympathetic. The sympathetic…

Q: Which of the following is normally reabsorbed completely from the glomerular filtrate? Select one:

A: The filtering unit of kidney is known as glomerular. By which the blood passing through and it also…

Q: 5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ The template strand is shown. The +1…

A: DNA and RNA govern transcriptional activity or the mechanism by which a gene's information is used…

Q: ble opposite shows the standard (coding strand) DNA codes for the 20 amino acids involved in protein…

A: Introduction :- Gene expression is the process of formation of response or functional part through a…

Q: 1. Under each sequence of bases, write the sequence of bases complementary to each section of DNA in…

A: Introduction : The primary nucleobases are cytosine (DNA and RNA), guanine (DNA and RNA), adenine…

Q: You have found a new base analog. It looks to the cell like an A, but it can also change shape and…

A: A mutation is a change occurring in a DNA sequence. These can result from DNA copying errors during…

Q: 3 The restriction endonuclease PstI cuts DNA symmetrically on both strands at the СTGCAG sequence:…

A: Restriction endonucleases are the enzymes that are used to form cuts inside the DNA molecule. It is…

Q: One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base…

A: DNA stands for deoxyribonucleic acid. It is made up of nitrogenous bases (ATGC), deoxyribose sugar…

Q: Double-stranded DNA replicates in a _____manner. When __________ strands separate, each serves as…

A: DNA (deoxyribonucleic acid) is a long polymer of deoxyribonucleotides. Chemicall. DNA is composed of…

Q: Restriction sites are palindromic, which means that they read the same in the 5′ to 3' direction on…

A: A palindrome sequence refers to a specific pattern of nucleotides that reads the same forward and…

Q: Which of the following statement about the DNA double helix is correct А. Sugar-phosphate backbone…

A: DNA is composed of nucleotides attached together via phosphodiester bonds. DNA is known as…

Q: Yes or no? No explanation. rna polymerase are recruiting to start transcription but promoters…

A: Dear student, As per our guidelines we are supposed to answer only one question. Please repost the…

Q: Fill in the blank. As helicase unwinds closed circular DNA, it compensates for positive…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: ררד חויתוידורידיד" The above image shows DNA during replication. The new DNA strand build using the…

A: Replication typically begins at a specific point on a dna sequence known as the replication origin.…

Q: What is the function of DNA gyrase? O a prevents the two complementary template strands from bonding…

A: DNA replication is the process of formation of replica of DNA. It involves various enzymes which…

Q: double-stranded DNA is dissociated into

A: All organisms must replicate their DNA when cells divide. During DNA replication, an enzyme called…

Q: Template strand/Sense strand Coding strand/Antisense strand Region of DNA unwinding Region of DNA…

A: The sense strand, or template strand, is the only strand that is effectively employed as a template…

Q: coding strand A mutated sequence of DNA CA C GA AT TAGAT GG 5' 3, 5' C T AT GT G C T TA ATC TAC C…

A: Coding strand of DNA:- The DNA strand present in the direction of 5' to 3' acts as coding strand.…

Question

### DNA Fragment Sticky End Exercise

**Objective:** Understand the generation of sticky ends in DNA after BsaI digestion.

**Problem Statement:**
Below is a description of a double-stranded DNA sequence. After digestion with the BsaI enzyme, this DNA fragment will have sticky ends as shown in the diagram:

- **5’ GTAG** sticky end on the left
- **5’ CAGC** sticky end on the right

**Task:**
Replace the “N” bases in the provided sequence with specific double-stranded sequences. These sequences should ensure the correct sticky ends are formed post BsaI digestion. Include the BsaI recognition sequence and sticky end sequences in your answer.

**Example DNA Sequence with Sticky Ends:**

- **5’ End:**
- Original: `5’ GTAG`
- Sticky end planned: `5’ CAGC`

- **Sequence Template:**
```
5’ - NNNNNNNNNNNNNNNN ... NNNNNNNNNNNNNNNN - 3’
3’ - NNNNNNNNNNNNNNNN ... NNNNNNNNNNNNNNNN - 5’
```

**Instructions:**
1. Identify the BsaI recognition sequences in your lab manual.
2. Modify the “N” bases to incorporate these sequences, ensuring the correct formation of the sticky ends:
- **Left:** Add nucleotides to create the 5’ GTAG sticky end.
- **Right:** Add nucleotides to create the 5’ CAGC sticky end.

Feel free to either remove or include extra “N” bases as needed for clarity.

### Diagram Explanation:
The diagram shows the DNA orientation and the expected sticky ends resulting from BsaI enzyme digestion. You start with sequences labeled as "N" bases, and your goal is to modify them according to the given task, ensuring proper sticky ends are achieved.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Trending now

This is a popular solution!

Step by step

Solved in 4 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

You have another circular plasmid. Complete and effective digestion of this plasmid with a restriction enzyme yields three bands: 4kb, 2kb, and 1 kb. In comparing the band intensity on an ethidium bromide-stained gel, you notice that the 4 kb and the 2 kb bands have the exact same brightness. The 1 kb band is exactly one fourth as bright as each of these. (Assume there is uniform staining with ethidium bromide throughout the gel.) How many times did the enzyme cut the plasmid? What is the size of the plasmid? Justify your answers to a and b above using a clearly labeled diagram showing the relative location of the cut-sites on the plasmid.
Replicate, transcribe and translate the DNA strand below. Be sure to label your 5’ and 3’ ends and the complementary and template strands.
Your DNA has been mutated! Carry out the following mutations, separately: a) In the original sequence, change the blue C (arrow 1) to a T. Transcribe and translate again. mRNA: 5' 3' amino acids (single-letter): b) In the original sequence, change the red C (arrow 2) to a G. Transcribe and translate again. mRNA: 5' 3' amino acids (single-letter): c) In the original sequence, change the purple G (arrow 3) to a T. Transcribe and translate again. mRNA: 5' 3' amino acids (single-letter): d) In the original sequence, delete the green G (arrow 4). Transcribe and translate again. mRNA: 5' 3' amino acids (single-letter):
Please ASAP. Thank you.
Please ASAP. Thank you
The hydrogen bonding of the specific pairs of bases shown above provides for ___? Preserving the sequence of genes during DNA replication Transcribing the sequence of DNA into the sequence of RNA Translating the sequence of RNA into the sequence of amino acids in proteins
Pls help ASAP! (Options are True or False for all drop down options)
5'-GCGGTACGTTACGGCTTTACTGACCTGCAGGC-3' A. Convert this to a double strand DNA molecule by writing the complementary sequence. Be sure to correctly label the ends of the double stranded molecule B. Pick one of the two strands and write the sequence of an RNA molecule that could be transcribed from it. Again, you must correctly label the ends of the molecule.
Please ASAP. Thank you
Match the strands (W - Z) to their role in replication (leading or lagging) 3' ||| 5 W Leading A. В. lagging z in
8