Yeast cells grew from 19 to 54 kg dry cells m-3 in 7 hours. During this period 81 g of glycerol was consumed per 1L of the fermentation broth. Determine the average specific growth rate and the cell yield with respect to glycerol.
Q: Using your knowledge of the central nervous system and various cell-cell interactions, identify the…
A: The central nervous system (CNS), which includes the brain and spinal cord, is an essential…
Q: Match each function to its site of action in the nephron. Glomerulus- Proximal- convoluted tubule…
A: Kidneys are bean-shaped organs present in pairs in humans located in the abdomen. The function of…
Q: Which of the following mechanisms of evolution would have the SMALLEST impact on allele frequency…
A: An allele is one of two forms of a gene. Allele frequency describes how common an allele is in a…
Q: Cross Section of Earthworm
A: Earthworm is a terrestrial invertebrate organism that is found in soil. The phylum of earthworm is…
Q: 1 1 is is 6 is 2 , 3 is ,5 is 3 2 Question 11 6 4 .5 is ,4
A: The bones have a Haversian system and hard matrix with lamella is called compact bone or ivory bone.…
Q: Glutamate is NOT secreted into a bipolar cell. Which of the following could be a possible message…
A: It is the anion of glutamic acid and plays a crucial role as a neurotransmitter. It is the most…
Q: make a concept map out from the essay below. The epic story of a single sperm facing incredible…
A: Fertilization is a multi-step, complex process that takes 24 hours to complete. The beginning of…
Q: 1 11 ||| IV V Examine the pedigree and determine which of the following modes of inheritance best…
A: A pedigree analysis is a flowchart depicting the inheritance of a trait. It is useful in finding…
Q: is i 5' AACGATGCCATCAGAGCCCAGGACGTGATTTAA TTGCTACGGTAGTCTCGGGTCCTGCACTAAATT Ċ (c) wha 3' 5' se that…
A: Transcription is a process in which mRNA is synthesized with the help of DNA by the help of the…
Q: 1.Systemic arteries/arterioles 2.Systemic capillaries 3. systemic veins/venules 4. Lungs (or going…
A: Heart is a central pumping organ. Most of the blood is pumped by the heart to different parts of the…
Q: Consider a gram negative pathogen isolated from marine mammals. This pathogen is subjected to a…
A: Here in this question we are given certain characteristics and on the basis of it we have to…
Q: Draw fungal structural (spores) are mostly indicated with PINK stain (except in Image 5).
A: As per our company guidelines we are supposed to answer only first 3 parts. Kindly repost other…
Q: Name Zona A Fill in the lodowing statement Dut is the movement of Osmosis BEAKER 10% BEAKER #2 CELL…
A: The process by which water (solvent) moves from higher water potential area to the lower water…
Q: The limbic system utilizes specific pathways in the brain to prevent sensory overload and help with…
A: The limbic system and the reticular activating system (RAS) are two distinct components of the human…
Q: Original DNA DNA Protein TACGCTATGAGC Methionine-Arginine-Tyrosine-Serine Mutation #1 DNA What type…
A: Mutation is the genetic change in the genome due to the gain or loss of any gene. These changes may…
Q: The image attached is a drawing of a Columnar Epithelium slide with the 40x objective lens. There…
A: The lining of the digestive tract (stomach, small intestine, and large intestine), the respiratory…
Q: The following four plants have been identified as having the listed gametophytic…
A: Self-incompatibility (SI) is defined as the inability of a fertile hermaphrodite plant with stamens…
Q: which one is true. Consider this claim: "If a card has a shark on one side, then it has a…
A: A trait is a particular, distinguishable quality or attribute of a person or an organism. Physical…
Q: Starting with the carbon in the glucose molecules, show how ONE glucose: 1) gets into the cell 2)…
A: Glucose is a six carbon molecule which is the fuel used for energy generation inside the living…
Q: 1. Which of the following could most quickly reverse calmodulin activity ? ADP A plasma membrane…
A: Calmodulin (CaM), also known as calcium-modulated protein, is a multipurpose intermediate…
Q: Let's pretend that there is a community called Zygozia. They say that they founded their small…
A: The process by which the frequencies of genetic features alter over generations within a population…
Q: C. What genotypes lead to the phenotypes of the F2? What phenomenon is occurring in the F2…
A: Saccharomyces cerevisiae, bakers yeast is an model unicellular organism for genetic experiments. It…
Q: Question 21 In plants, ____ are produced by meiosis. flowers spores Gametophytes sporophytes…
A: The sexual reproduction in plants is responsible for the production of haploid (n) male (polen) and…
Q: 6 = W - 1 A 2 C ♦ ( ◆ ♦ N/A (> ◆ ◆
A: In a complementation chart a group will contain similar mutations that failed to compliment one…
Q: In pea plants yellow seed color, (GG) and round seed shape (WW) seeds are dominant traits, while…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: Bacteria can grow under a variety of conditions but also have growth preferences. Bacteria that…
A: The need for oxygen may be used to categorize different types of microorganisms. The way that…
Q: Which of the following is TRUE about gametes? a) undergo meiosis b) formed by mitosis c) always…
A: Please note, the given questions are four different questions and not sub-parts of one question.…
Q: Case #5: Native Americans and Type O Blood Modern Native Americans have very high frequencies of…
A: Evolution is described by a phenomena in which lots of changes accumulate over thousands and…
Q: Toll-like receptor stimulation in both myeloid dendritic cells and plasmacytoid dentritic cells will…
A: TLRs are type 1 trans membrane proteins that extend from one leaflet to the other leaflet of the…
Q: Leopards are seen in a variety of patterns: spotted, black, and tan. Examine the following crosses…
A: Leopards are seen in a variety of patterns: spotted, black, and tan. Examine the following crosses…
Q: A detailed explanation of respiration under physiological processes in plants.?
A: Like animals and humans, plants do breathe. It is a crucial physiological process that takes place…
Q: Examine the phylogeny to determine which of the boxed off groups are monophyletic, paraphyletic, or…
A: A phylogenic tree is a schematic diagram which shows evolutionary relationship of the various…
Q: QUESTION 6 Match the best answer for each statement. Amino acids undergo to form polypeptides. RNA…
A: The organic compounds that contain both amino and carboxylic acid functional groups is known as…
Q: Which of the following is NOT a deuterostome? O Shark O Spider O Sea urchin Sea turtle
A: In the diverse world of animals, there are distinct developmental patterns that classify them into…
Q: Adherens junctions link together adjacent cells in an epithelial sheet through the lateral…
A: Adhersion junctions are mainly protein complexes that occur at cell cell junctions, also at cell…
Q: In assessing data that fell into two phenotypic classes, a geneticist observed values of 20:150. She…
A: Two phenotypic classes Phenotype 1 and Phenotype 2 observed values 20:150 and two different null…
Q: In Drosophila fruit flies, the gene controlling bristle length is X-linked. Wild type flies have…
A: In this particular scenario, we’re examining a gene that controls bristle length, which is X-linked.…
Q: Examine the table of characters given for four different species of flower. Species A Species B…
A: A primitive (or ancestral) character, trait, or feature of a lineage or taxon is one that was…
Q: A set of hermaphrodite self-crosses and male x hermaphrodite crosses were established, and the…
A: A hermaphrodite is an organism that possesses both male and female reproductive organs within a…
Q: Polyethylene glycol (PEG)-conjugated IFNs have superior pharmaceutical properties compared with…
A: Polyethylene glycol (PEG)PEG, short for polyethylene glycol, is a type of substance that is good at…
Q: Answer the following “cause-effect” true/false questions using the answer key: A: Only statement A…
A: According to the guidelines of Bartleby,"Since you have posted multiple questions, we will provide…
Q: In mallard ducks, Anas platyrhynchos, plumage is under control of a single gene with three alleles:…
A: If a gene exists in more than two alleles such condition is called multiple allelism. Eg. Blood…
Q: A substance that forms a complex with another biomolecule to exert a biological effect is called a:…
A: In the intricate realm of biology, various biomolecules interact and collaborate to orchestrate the…
Q: How can a skull of a specimen be classified as a Strepsirrhine?
A: Strepsirrhine are identified by their long snout and wet nose. This group includes lemurs and…
Q: Int. J. Mol. Sci. 2020, 21, 5129 A C B D 4 of 21 Figure 2. Micrographs documenting multipotent…
A: The study is to investigates the multilineage potential of canine Bone Marrow Mesenchymal Stem Cells…
Q: What is serotonin's role in dreaming? Is the primary receptor activating during dreaming 5-HT2A ?
A: Serotonin, a neurotransmitter, plays a complex role in regulating sleep and dreaming. While its…
Q: Answer the following “cause-effect” true/false questions using the answer key: A: Only statement A…
A: The questions inquired are related to the cause-effect relationship between two statements, each…
Q: Q4.7. In DNA replication, what is the difference between the leading and lagging strands? In the…
A: DNA replication is a mechanism through which cells make copies of the genome's DNA. A cell must…
Q: 1 kb B1 kb E 6 kb Gene X E1 kb B 5 kb. Gene Z Ечко! B 1 kb ← The figure above shows a linear…
A: Gel electrophoresis is a technique that is responsible for the separation of DNA, RNA and proteins…
Q: Which of the following are adrenergic fibers? most parasympathetic postganglionic axons most…
A: Sympathetic Autonomic Nervous System: This is the part of the autonomic nervous system in the spinal…
Yeast cells grew from 19 to 54 kg dry cells m-3 in 7 hours. During this period 81 g of glycerol was consumed per 1L of the fermentation broth. Determine the average specific growth rate and the cell yield with respect to glycerol.
Step by step
Solved in 4 steps
- Yeast cells has been cultured on glucose (Table 1). The growth data follows the Monod Equation Table 1: Growth data for yeast cells Glucose concentration (mg/L) 7 10 15 40 200 1000 Specific growth rate (h*¹) 0.066 0.088 0.12 0.294 0.330 0.364 0.419 0.451 0.2 0.304 0.340 0.458 Observed yield, Y'x/s (g/g) a) Calculate the maximum specific growth rate (max) and the substrate constant (Ks) b) Estimate the true yield Y'x/s and the maintainance coefficient ms c) Calculate the doubling time at a concentration of 15 mg/L glucose d) Calculate the substrate consumption rate (rs) assuming a substrate concentration of 40 mg/L and a biomass concentration of 100 mg/LYeast cells are added to a 3.0 L batch bioreactor so that the initial cell concentration is [X]. = 1.3 g cells / L. The growth mediğim in the reactor, which is well-mixed so the cells have access to all nutrients, contains 150 g CELL DATA ribose (C5H10O5, MW 150), 75 g ammonia (NH3, MW 17), and 85 g oxygen (O2, MW 32). A-10. Determine the maximum concentration of cells, [X], that will form in the bioreactor when the limiting nutrient is consumed. Search Yx/ribose YX/02 YX/NH3 Specific growth rate on limiting nutrient, u Lag phase duration Deceleration phase duration 0.48 g/g 0.87 g/g 0.23 g/g 0.51 h 30 minutes NegligibleIn aerobic respiration, cells generate heat as they grow. The amount of heat generated by cells is proportional to the amount of oxygen they consume. Accordingly, it was found that 460 kJ is generated per gmol of O2 consumed. Suppose that you need to choose a fermenter for optimal growth of Bacillus subtilis cells. It is known that the maximum oxygen demand of B. subtilis is 100 mol m3 h1. A vendor offers you a reactor with a cylindrical shape (2.8 m in diameter) and 15 m³ volume. The reactor includes a cooling coil with 30 m length and a pipe diameter of 6 cm, through which. For practical purposes, power input by the rotating impeller inside the bioreactor can be neglected. Does this reactor meet the cooling requirements of your production process? Note: If you think you need more information than you are provided with here to solve this problem, use online resources to find the required information. In this case, please state your source clearly. Note: You may assume that the…
- Determine the correct intended effect to the rate of fermentation of the following variations in the factors that influence yeast fermentation. Increase the concentration of sugary substrates. Decrease the recommended amount of inactive dry yeast. Keep the fermentation set-up in a room at 15 °C. Add more water to the fermenting solution to dissolve the substrates. Do not disturb the fermentation set-up for 1 week or longer. A. Decrease the rate of fermentation B. Increase the rate of fermentation C. No change in the rate of fermentationAaBbCcDd AaBbCcDd AaBbC AaBbCcC AaB AaBbC I Normal 1 No Spac. Heading 1 Heading 2 Title Subtit Paragraph Styles BIO 121 Section Yeast cells use sugars to undergo the chemical reactions of cellular respiration. We will test the ability of yeast cells to sucrose as an energy source for cellular respiration. We will examine if various concentrations of sucrose has an effect on cellular respiration and whether the temperature also plays a role in cellular respiration Answer these questions based on the video posted: Using this data table graph the data from the experiment in the video: Amount of Foam in the Yeast Experiment| Time 20°C/RT 30°C 40°C 50°C 60°C O min Ост Ocm Ocm Ост Ост 10 min 1.5cm 4cm 11cm бст Зст 20 min 2.5cm 9.5cm 17cm 11cm 9cm 30 min 4.5cm 13cm 18cm 10cm 11cm Using the data presented in the video for the yeast experiment draw a line graph. There are time points shown 0, 10, 20 and 30 minutes. Plot a line graph of foam level(s) for each temperature versus time (Time is on…Calculate the chemical equation product of 5 (C6H12O6) of the different fermentation 1. Alcoholic Fermentation 2. Acetic Acid Fermentation 3. Lactic Acid Fermentation
- Which growth condition shown above has the largest doubling time? How would you explain the observed growth data based on information about metabolism and oxygen requirements? Definitely take into consideration the relative growth of all three growth conditions. Surprisingly, cultures grown in anerobic conditions are non-motile, whereas cultures grown in normal O2 saturation have several peritrichous flagella and swim motility. Explain briefly the mechanism of flagellar motility in terms of energy source for flagellar motility and why it may be lower in anaerobic conditions for L. monocytogenes.Table 3 - Determination Tube # Potato Expt. Temp. 2c 3c 4c 5c extract (mL) 2 2 2 2 room temp 20 °℃ 40 °℃ 75 °℃ Boiling 100 °C of the optimum temperature of catechol oxidase enzyme. 1st Absorbance 0 min. at Expt. Temp. dH₂O Catechol (mL) (mL) 0 0 0 0 13 13 13 13 Start Time: 4:20 Absorbance: 0.072 Start Time: 4:25 Absorbance: 0.114 Start Time: 4:25 Absorbance: 2nd Absorbance after 10 min. in Expt Temp. Absorbance: 0.097 Time for reading: 4:30 Absorbance: 0.128 Time for reading: 4:33 Absorbance: Subtract 1st from 2nd absorbance 0.056 0.137 Time for reading: 4:35 Absorbance: 0.132 0-193 Start Time: 4:27 Time for reading: 437 Absorbance: 0-126 0.023 0.061 0.029 3rd Absorbance after 10 more min. at Room Temp. Time for reading: 4:40 Absorbance: Based on the data from Table 2 answer these questions: Q10) What is the enzyme's optimum temperature? Answer: Q11) Use the difference between 2nd and 1st absorbance to support your conclusion for the optimum temperature. 0.159 Time for reading: 4:43…Consider the growth curve shown below. Cells were grown in a medium containing 1 % w/v glucose and 0.5% w/v acetate. Calculate the generation time when growing on glucose and also when growing on acetate. Pay particular attention to the split time axis with different time scales. Glucose generation time = hrs Acetate generation time = hrs 1011 1010 109 108 107 106 105 104 10 15 20 25 30 time (hours) HA log of numbers of bacteria LO
- Switchgrass is used for ethanol production. The composition of the switchgrass is 37% cellulose, 24% xylan, 3% galactan, 4% arabinan, 20% lignin, 7% extractives, and 5% ash. A dilute acid pretreatment method is applied to the switchgrass before enzymatic hydrolysis and fermentation. The pretreatment hydrolyzes 10% hexosan and 90% pentosan into monomeric sugars. Approximately 30% of the hydrolyzed pentoses further react & are decomposed to furfural. Assume that there is no decomposition of the hydrolyzed hexoses. Further Assume that lignin, extractives, and ash do not change during the pretreatment. • How much of each lignocellulosic sugar (glucose, xylose, galactose, and arabinose) is produced when pretreating 1,000 kg (dry matter) switchgrass? How much furfural is formed? • Is water consumed or produced in these pretreatment hydrolysis and dehydration reactions? How much in each?Graph these two datas with correct y axis ( label absorbance and time) of the amylase effects on carb cutter and compare the two graphsAnalysis that compares the results obtained from the growth of S. thermophilus under varying temperatures and pH conditions. The graphs are shown below a) b) 25- 2.0p 1.8 1.6아 7.0 20 1.4 6.0 1.2 1.아 0.8 0.6 13- 30 °C +37 C 45 °C 5-0 0.4 0.2 0.0 02468 10 12 14 16 18 20 22 24 4-0 Time (h) timelh] The growth curve and pH of Streptococcus thermophilus in the medium. Growth curves of Streptococcus thermophilus at different temperatures (30°C, 37°C and 45°C). Justify how the survival of yogurt cultures used to increase the quality of dairy products. Hd Viable counts (so CFU/ml)