Write out the DNA sequence using the following instructions: This is a double stranded DNA hydrogen bonding with each other following the principle of complementary base-pairing Each strand contains ten nucleotides Each strand contains all four different types of nucleotides You should indicate clearly the directionality of each strand in your answer You do not need to draw the full nucleotide structure. Use the one-letter code (A, T, G, C, or U) to represent each nucleotide

Q: In one paragraph, using your own words, describe the structure of DNA. Be sure to include the…

A: Introduction :- DNA, or deoxyribonucleic acid, is a long, double-stranded molecule that contains the…

Q: omplete what is being asked and finally with the Genetic Code table, determine what specific amino…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: Sketch a DNA molecule (in a vertical lateral position) and connect the the appropriate region in the…

A: DNA is a double helix molecule made up of sugar phosphate backbone and nitrogenous bases like…

Q: the difference between the chemical structures of DNA & RNA and state the said difference in a short…

A: Both the DNA and RNA are made of nucleotides , containing a fivecarbon sugar backbone (pentose) , a…

Q: Fill in the blanks in the selection below. Use the video to help you. A DNA molecule is made up of a…

A: The process by which the parental characters are inherited from the offsprings is known as…

Q: Suppose you are analyzing a nucleic acid sequence which contains guanine, cytosine, adenines, and…

A: DNA: DNA is a polymer made up of two polynucleotide chains that coil around one another to form a…

Q: The following strand of DNA is transcribed: 5'-GACCTCCGAATGC-3' Write the sequence of the…

A: Transcription:  It is the process of synthesis of mRNA from double-stranded DNA by the enzyme RNA…

Q: Please help me make an abstract using the information below it is the result and discussion of the…

A: DNA i.e. Deoxyribose nucleotide : It consists of nitrogen bases i.e. Adenine , Guanine , Cytosine…

Q: Part of being a detective is being able to decode secret messages left behind by certain…

A: The given DNA sequence is: 5'- TATGCTAGGCATTGTCGTAGGCATACG -3' 3'- ATACGATCCGTAACAGCATCCGTATGC -5'

Q: On the diagram of this DNA molecule, match the letters to the corresponding components: (should only…

A: In the diagram below DNA is shown. DNA is made up of a monomer called nucleotide. Each nucleotide…

Q: Can you please check my answer and make sure it is correct? Question: Why are hydrogen bonds so…

A: Hydrogen bonds are a type of attractive interaction between an electronegative atom and a hydrogen…

Q: Translate this nucleotide sequence into an amino acid sequence. Gene Sequence (5'-to-3'):…

A: Translation is a biological process that converts a nucleotide sequence into an amino acid sequence.…

Q: What would fit best for right properties of dna?

A: Introduction: DNA may be a chemical basis of heredity and will be thought to be the depository…

Q: Which well(A through E) of this agarose gel contains the smallest DNA size? Please look at the pic.

A: Gel electrophoresis technique of separation of molecules on the basis of their size and charged…

Q: Shown below is a DNA coding strand: 5' T-A-C-T-T-C-C-C-G-A-T-C-A-T-T 3' Using the genetic code…

A: The genes in DNA encode protein molecules, which serve as the cell's "workhorses," performing all…

Q: Use the genetic code table to determine the amino acid sequence of the given message strand of DNA…

A: Proteins are made up of amino acids, which are a type of molecule. The basic components of life are…

Q: The nucleotides are very specific as to which bond together. The four nucleotides are:Adenine (A)…

A: DNA nucleotides are adenine (A), thymine (T), guanine (G) and cytosine (C). These nucleotides come…

Q: To answer the prompts below, draw on a piece of paper or your tablet the chemical structure of the…

A: The trinucleotide sequence is:5' - TCA - 3'The complementary trinucleotide sequence will be:3' - AGT…

Q: What is the complementary sequence of the following DNA strand: AATCGTCTAAGGCC

A: The objective of this question is to find the complementary sequence of a given DNA strand. In DNA,…

Q: 5. Looking at the polymer, why is a DNA considered antiparallel? 6. Why are the ends of DNA strands…

A: DNA is made up of nucleotides, the monomeric building blocks of the DNA. Each DNA polymer consists…

Q: Identify the key structural features of a DNA molecule.

A: DNA i.e. Deoxyribonucleic acid is the molecule that carries genetic information for the development…

Q: Draw a generalized nucleotide. Just put “base” instead of drawing the actual base. Label the carbons…

A: Nucleotides are the monomer units of biological polymers nucleic acids (DNA and RNA). They composed…

Q: Answer the following 2 questions based on the given sequence of DNA. The top strand is the template…

A: The central dogma of DNA consists of transcription and translation. In transcription, the DNA makes…

Q: For each term in the left column, select the term which best matches. 1. deoxyribonucleotide 2.…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…

Q: Draw and label a diagram showing four DNA nucleotides, linked together in two strands. PLEASE DRAW…

A: Nucleic acids are biomolecules responsible for the storage and transmission of genetic information…

Q: figured out that the protein sequence was:   Met-Ala-Arg-Gly-Trp-Ala-Pro   Work backwards…

A: In this process first of all RNA sequence could be find out by the genetic code. Later on  sequences…