With respect to wobble hypothesis all of the following are correct except: An inosine nucleotide in the mRNA molecule can base-pair with A, C, and U in the tRNA The anticodon shows both standard and non-standard base pairing with the codon at wobble position Guanine can base-pair with uracil An inosine nucleotide in the tRNA molecule can base-pair with A, C and U in the mRNA

Q: All of the following mRNA codons signal the end of translation, in both prokaryotes and eukaryotes,…

A: The translation is a molecular process of synthesis of protein from genetic information encoded in…

Q: Self-bonded and looped sequences near the end of single poly-ribonucleotide chains control gene…

A: Gene is the sequence of nucleotide that encodes a specific protein.

Q: what are the steps of translation in order based on when they occur? It would be nice if some…

A: Translation is the process by which a protein is synthesized from the information contained in a…

Q: How many codons can mutate to become nonsense codons through a single base mutation of the first…

A: The association of 5mC with alternative splicing also challenges the general repressive role…

Q: Which of the following types of mutations, resulting in a change in the mRNA just after the…

A: The translation process will result in the creation of proteins. The process of protein synthesis is…

Q: Human Fbh1 helicase is important in the process of DNA replication. When a muta occurs during the…

A: Introduction : 1) DNA replication is the process by which the genetic material is copied within the…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: Draw a labelled diagram depicting the flow of genetic information from DNA to mRNA of a eukaryotic…

A: A fundamental principle that describes how genetic information moves throughout a biological system…

Q: Which of the following statements is true?    RNA polymerase can only add a nucleotide to the 5'…

A: The production of RNA from the DNA template is known as gene expression or transcription that occurs…

Q: Which two functional groups are present in an amino acid? Immersive Reader a Amino and carboxyl…

A: Proteins are linear polymers that are built of monomer units known as amino acids. Nearly 500 amino…

Q: . The human gene for ß2 lens crystallin has the components listed below. The numbers represent…

A: Since we only answer up to 3 sub-parts, we’ll answer the first three. Please resubmit the question…

Q: A gene affecting the behavioral outlook of individuals was discovered in several humans who can…

A: Transcription is the process of the formation of RNA from DNA. Through transcription, the…

Q: Select all that apply: Beginning at the 5' end of the DNA, which answer choices place a gene's…

A: Gene or DNA is the basic mode of transfer of inheritance from one organism to another (parents to…

Q: Classify the following functions or structures as being attributed to proteins, RNA, or RNA-protein…

A: A. Proteins -  Poly A polymerase Release factors (RF1 and RF2) Formation (catalysis) of peptide…

Q: The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGGT 3'. Starting from the start…

A: The nucleic acids DNA and RNA are found in all living things. The deoxyribose nucleic acid is DNA,…

Q: You perform a translation experiment with MRNA and all required molecules in two identical test…

A: Puromycin is a tyrosyl-tRNA mimic that works by identifying and releasing elongating polypeptide…

Q: Which of the following is always true of ribosomes? aM I CORRECT?

A: Ribosomes are organelles that are found in both the eukaryotes and prokaryotes. Ribosomes are…

Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…

A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.

Q: Which of the following is not true?   There are two major classes of aminoacyl-tRNA synthetases…

A: Central dogma includes three main processes Replication, Transcription, and Translation.…

Q: What are the specific steps of eukaryotic translation? Be sure in your discussion that you include…

A: In transcription, a cell “copies” DNA sequence to a complementary RNA molecule. Then, in…

Q: Which of the following statements about a transversion mutation in the sequence AGC is true?

A: Transversion alludes to a point mutation in DNA in which a solitary (two rings) purine is changed…

Q: Which of the following is the initiator tRNA for all bacterial proteins? O Formyl-cysteinyl-TRNAACG)…

A: Question - Which of the following is the initiator tRNA for all bacterial proteins?…

Q: Splice sites on mRNAs are located with the help of all of the following EXCEPT:   Question 9…

A: Introns are cut off at splice sites along a pre-mRNA sequence, and exons are connected at these…

Q: Is the answer mRNA or Exon?

A: The following are further details about  each option: Exons:Incorrect.Exons are the coding regions…

Q: Here is a schematic map with a scale of a eukaryotic gene. How long is the processed mRNA transcript…

A: Gene is the sequence of nucleotide that encode a particular amino acid. It is found in DNA.

Q: Why do humans have such a large number of nucleotides (3.2 billion base pairs) compared to the…

A: The genome is the sum total of all genetic material of an organism which stores biological…

Q: Look at the MRNA strand below. There are at least a few bases before the "AUG" or the start codon.…

A: Several codons or triplet bases make up the universal genetic code. Over time, the standard code has…

Q: The synthesis of a protein requires that the amino acids that constitute the growing polypeptide…

A: In the intricate dance of cellular processes, protein synthesis takes center stage, orchestrating…

Q: Which of the following is/are true? 1. Oils are different from fats because they are plant derived…

A: Oils are different from fats because they are plant derived and mostly contain unsaturaded fatty…

Q: In test tube 1 (no puromycin) you get a polypeptide that is 90 amino acids long. At least how many…

A: The translation is the process of the formation of polypeptide chains of amino acids that lead to…

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…

Q: Here is a schematic map with a scale of a eukaryotic gene. How long is the primary mRNA transcript…

A: The mRNA is produced by the process of transcription.

Q: A DNA

A: DNA acts as the genetic material in most of the organisms . DNA stands for the deoxyribonucleic…

Q: help

A: The mutations causing most likely (1) to least likely (4) a loss of the function of the encoded…

Q: When given the DNA message sequence, 5'-ACT-3', what would be the corresponding DNA template strand…

A: In biology, a DNA strand is the double-stranded molecule of nucleic acid that serves as the…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.