Why His/Lys preceed Arg? b) Why Asp preceeds Glu?

Q: Explain The organization of the human neurexin genes?

A: Neurexin genes code for neurexin proteins that are responsible for the presynaptic interaction…

Q: Identify the experimental techniques used to study protein targeting.

A: Protein targeting is the process by which proteins are directed to specific cellular compartments or…

Q: Explain the process of adenoma or polyp ?

A: The suffix "-oma" is used in medical terminologies to indicate cancer. Adenoma refers to the…

Q: Determine whether each of the statements describes amyloid beta (AB) in Alzheimer's disease (AD),…

A: A protein's biological function depends on its three-dimensional structure. The 3D structure is…

Q: Write the name of lysosomal storage disorders.

A: Lysosomal storage disorder are also known as sphingolipidoses, in which sphingolipids are…

Q: What stimulates the switch to the lytic pathway?

A: The bacteria that get infected by the viruses are known as bacteriophages. The virus inside the…

Q: HindII --- 5' GTC - GAC 3', HaeIII --- 5' CC - GG 3', EcoRI --- 5' G - AATTC 3' and BamI --- 5'…

A: Restriction enzyme varies from one other in their restriction sites as well as the type of ends they…

Q: Describe the phenotype for the following two diseases and name the gene linked to each disorder. a)…

A: Genetic disorders  Genetic disorders are caused due to mutations in the gene of an individual. These…

Q: How the genes, when mutated, contribute to the development ofcancer ?

A: Mutation can be defined as the alteration in the nucleotide sequence of the genome of an organism,…

Q: Define Crygc gene.

A: CryGC or crystalline Gamma C gene is a protein-coding gene belonging to the beta/gamma crystalline…

Q: The main function of t-RNA isa) Proof readingb) Inhibits protein synthesisc) Identifies amino acids…

A: Transfer RNA, also known as soluble RNA is an adapter molecule that is composed of 76 to 90…

Q: In a Ccpp individual, which functional enzyme ismissing? Is it the enzyme encoded by the C or P…

A: Recessive Allele is the result of a loss of function mutation.

Q: 2- a) Draw the structures of the three antigens that determine the blood type in humans. i.e. draw…

A: Blood group is determined by the presence and absence of the antigen. The plasma membrane of RBCs…

Q: What is “EMLA”? Give its purpose?

A: A human being's nervous system is a complex system that helps to coordinate behavior and transmit…

Q: The initiation complex for translation includes transfer RNA-MET. Select an answer and submit. For…

A: During initiation,at the start of mRNA sequence the small ribosomal subunit binds.Then a tRNA…

Q: Qy: d whicel folowing Sucturs reprasent Perfeet orl trap? why? One The

A: Oil traps are formed as the vertical layers of the rock shift shift and move causing the oil deposit…

Q: explain the  use of F′ episomes for complementationstudies

A: F' episome is the plasmid that has the ability to exist independently or to become integrated into…

Q: Explain Synpolydactyly caused by mutations in the human HoxD13 gene.

A: Synpolydactyly (SPD) is a rare congenital distal limb malformation, which is characterized by the…

Q: Define the term pyri-dostigmine?

A: Pyridostigmine is acetylcholinesterase inhibitor used as a medication to treat myasthenia gravis ,…

Q: Regarding albinism, name and briefly describe diagnostic procedure(s) that can be used to detect the…

A: The term albinism usually refers to oculocutaneous albinism (OCA). It is a set of genetic illnesses…

Q: Design a simple experiment to confirm that agglutination was due to the binding of the lectins to…

A: Answers agglutination is the aggregation of the particles. This phenomena is commonly observed when…

Q: 5'-CCGATATAATGAGTCGTCGTCTGGGCCTTCATGTATTCATGGGAAGAGAGTGTAATGTTTGCCTAAGGCC -3 70…

A: As per the central dogma of molecular biology, the genetic information stored in the DNA is copied…

Q: What is mutator phenotype ?

A: A mutator is called an agent or a chemical that can cause the mutation. Phenotype is defined as the…

Q: Expand the following : i) GIFTii) ICSIiii) IUCD

A: GIFT is a technique in which male and female gametes are directly injected into the fallopian tube…

Q: what is the the function of the protein related to KGD1

A: KGD1 is referred to as the mitochondrial alpha ketoglutarate's subunit. It is a very important…

Q: What is microsleep?

A: Sleep is a state our body requires to rejuvenate and to do the regular activities normally. It is a…

Q: How does the virus enters the nucleys?

A: Most of viruses are dependant on nuclear proteins for replication process. Various strategies are…

Q: What will be the effect of mutation that turns lysine to arginine

A: The mutations occur in genomic DNA but they will reflect in the form of protein sequence and…

Q: which gene is mutated in type la maple syrup urine disease?

A: Maple syrup urine disease is associated with problems with feeding, vomiting, low energy levels in…

Q: Define gene locus

A: Gene is basic unit of heredity that is responsible for physical and functional activity.

Q: Explain the Postreplication Repair ?

A: Deoxyribonucleic acid (DNA) stands for deoxyribonucleic acid. It is a biomolecule found in the…

Q: Define common variants

A: A common variant is a part of a hypothesis "Common diseases-common variant" that accounts for the…

Q: who can receive from a b- donor?

A: Ans. A person who willingly donates blood to help save lives or fund medical procedures is known as…

Q: How does DNOC act?

A: 4,6-Dinitro-o-cresol (DNOC) is an organic compound that was used as a pesticide. It is extremely…

Q: what is the configuration of c6h1206

A: Glucose, which has the molecular formula C6H12O6, is a simple sugar. The configuration of glucose is…

Q: What are BAC vectors?

A: Cloning vectors are the vehicles that are used in carrying the foreign DNA molecules. The cloning…

Q: What is a multisubunit protein?

A: The cells are the basic building blocks of the living system. It consists of many internal…

Q: 11. Differentiate pUC18 from PBR322 (Give two differences).

A: Plasmid : It is a circular dsDNA molecule . Naturally occurring plasmids are viruses of bacteria.…

Q: ZRS → 25. A2-day-old full-term female newbor suddenly develops bilious emesis, abdominal tenderness,…

A: The objective of the question is to identify the most likely additional abnormality in a newborn…

Q: Explain the Xinactivation center (Xic) ?

A: X Chromosome: Humans generally have one pair of Sex chromosomes, XX for females and XY for males in…

Q: Determine the results of an insertion of TA between positions 2 and 3.

A: 5' GTAGGGAGAACGAGACAATCTG  3' DNA 3' CATCCCTCTTGCTCTGTTAGAC  5'   5'GUAGGGAGAACGAGACAAUCUG 3' mRNA…

Q: Treatment protocols for COVID19?

A: COVID 19 is a term for coronavirus disease caused by a virus known as SARS-CoV-2 (severe acute…