An intermediate folding stage seen in protein denaturation or renaturation is called : a) domain  b)  motif   c)  subunit  d)  molten globule Proteins which do not renature spontaneously when denaturation conditions are removed may need the assistance of: a) a prosthetic group b)  a higher salt concentration   c)  a lower temperature  d)  a chaperone protein The information needed for correct protein folding is encoded in: a) the surrounding molecules  b)  the protein’s amino acid sequence  c)  the pH of the aqueous medium  d)  the electrolyte composition of the aqueous solution

Q: e? A)A gene's promoter sequence is transcribed into mRNA. B)Translation begins at the 5′ end of a…

A: Transcription is the process of formation of mRNA from the DNA.and Translation is the process of…

Q: Based on what you know about the structure of GPCRs, they must have: a)One internal start transfer…

A: Proteins destined for secretion outside the cell or lumen of an organelle are first targeted to the…

Q: 4- a) b) data How can bioinformatics tools be used to study posttranslational modifications? By…

A: The area of bioinformatics, which combines the study of biology, information technology, and…

Q: You want to mutate a Trp residue which is located in the interior of a protein structure. Which of…

A: Amino acids are the monomers that are bonded by peptide bonds to make polypeptide chains.

Q: What signal does the chaperone-mediated autophagy pathway of protein degradation use to identify…

A: A cellular mechanism called chaperone-mediated autophagy (CMA) is involved in the destruction of…

Q: All of these materials are needed for translation EXCEPT: O A) TRNA O B) ribosomes C) RNA polymerase…

A: Translation, in molecular genetics, is the mechanism by which ribosomes in the cytosol or…

Q: Chloramphenicol blocks the peptidyl transferase reaction on ribosomes. The specific effect of this…

A: Transcription:  It is the process of formation of RNA transcript from DNA template by the enzyme DNA…

Q: 14) (recall) A particular triplet of bases in the template strand of DNA is AGT. The corresponding…

A: During the method of transcription, the data encoded inside the deoxyribonucleic acid sequence of 1…

Q: For what reasons is it important to know the structure of a protein? a) Because then you can fold…

A: The proteins are made up of amino acids and the structure of proteins is classified as primary,…

Q: 7) The figure below shows a B-barrel protein embedded in a hydrophobic membrane. The central cavity…

A: Beta barrels are known to be embedded in the membrane for various functions like transport of cargo.…

Q: Which ribosomal subunit has the catalytic function for polypeptide biosynthesis? O a) the mRNA Ob)…

A: The larger ribosomal subunit, also known as the 50S (or 60S in eukaryotes) subunit, is liable for…

Q: nucleic acid.  b) . What is/are the major chemical difference(s) between RNA and DNA?

A: It is the question about nucleic acid i. DNA and RNA. Both DNA and RNA  are nucleic acid but though…

Q: A cytokine/growth factor that induces inflammation and promotes cell death. a) Cdk1 Ob) TNF O c)…

A: Tumor necrosis factor (TNF) is a cytokine that plays a critical role in the inflammatory response.…

Q: The growing peptide extends out of a tunnel located above the ...   A) A site B) P Site C) F…

A: Ribosomes are composed of two subunits, one small and one large. Four binding sites are located on…

Q: Which THREE of the following characteristics are the same in both DNA and RNA? A) deoxyribose sugar…

A: Nucleic acid are the macromolecules which are found in the cells or the viruses. It is of two types…

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: During protein synthesis, one amino acid binds to RNA molecules. a) What is this RNA molecule? b)…

A: The process of formation of Amino acids from mRNA molecule is known as translation.

Q: Which of the following sequences in the coding strand of the DNA could code for this peptide? Select…

A: Amino acids are coded by codons (trinucleotide sequences of DNA or RNA). Specific codons code for…

Q: What type of damage does UV light do to DNA?

A: 1) What UV light or Radiation must be doing to cells or DNA?

Q: Shown below is an internal fragment of a polypeptide. If this polypeptide were growing, onto which…

A: The incorporation of an amino acid into a protein follow specific trend with respect to the ends of…

Q: In one (1) sentence point out a key functional similarity and difference in each of the pair of…

A: Amino acids are the building blocks of proteins that are classified as acidic, basic, and Amino…

Q: Post-translational modifications of proteins include all the following EXCEPT a) alteration to the…

A: Translation is a process in which the RNA is translated into protein.Post translational modification…

Q: Dehydration synthesis always results in the formation of which of the following? A.)Water B.)Amino…

A: A process in which complex substances are made from simpler ones by removing water.Dehydration…

Q: Consider the image of the attached protein.  Now imagine you have a proteolytic enzyme that cleaves…

A: The mentioned proteolytic enzyme cleaves the peptide-bonds on the C-terminal sides of basic amino…

Q: Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which…

A: CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator…

Q: Which of the following is true for the tRNA of eukaryote cells? tRNA is a) made of DNA and protein,…

A: In nucleus the tRNAs are prepared and released to the cytoplasm. In there they attached to amino…

Q: If a protein is made up of 1000 amino acids   1) How many nucleotides will its mRNA contain…

A: Amino acids are the building blocks of proteins, which are responsible for the expression of genes.…

Q: n PLP dependent enzymes, what amino acid is initially bound to PLP in the PLP-Schiff base state? a)…

A:

Q: Which of the following sequences could NOT be used as an anticodon in a cell? Question 41 options:…

A: Codons are present in mRNA .it is made up of 3nucleotides .tRNA has a anticodon loop which makes…

Q: All of the following are directly involved in translation excepta) promoter.        b) ribosome.…

A: Introduction: The chemical nature of genes, such as genetic information encoding, gene expression,…

Q: Erk and P-Erk live in two different locations within the cell even though they are just two…

A: * Mitogen activated protein kinase also called as  MAPK and  p42MAPK, and ERK2 * It is an enzyme…

Q: 9)(recall) During translation, what TYPE OF MOLECULE carries amino acid to the site of protein…

A: The explanation is given below for the above answers.

Q: After tmRNA releases an mRNA and aberrant polypeptide from a stuck ribosome, the resulting…

A: Introduction : The translation is the process by which the protein molecules are synthesized from…

Q: Which of the following ribonucleopote in complex has an RNA component that is critical for its…

A: Ribonucleic acid (RNA) is a kind of biological macromolecule that is essential for gene expression…

Q: re-mRNA must undergo which of the following modifications before leaving the ucleus? a) introns…

A: Gene expression begins with the transcription of DNA into messenger RNA (mRNA), which is then…

Q: Beta barrel is a type of: a) subunit b)motif c) domain d) transport protein

A: Beta barrel is a protein structure that consists of beta sheets. A closed barrel or toroidal…

Q: Which level of protein structure would be most affected by the following changes... a) mutation from…

A: Structure of a protein  Primary structure: refers to the sequential arrangement of amino acids in a…

Q: Write the decarboxylation process for: a) serine, b) histidine, c) tryptophan.

A: Amino acids are biomolecules with a central carbon atom attached to an amine, carboxyl, and an R…

Q: Only answer please, no need to explain… Thank you for your time. i:  Modification of the 5 prime…

A: Answers :  i) capping    ii) all of these    iii) transcription

Q: A protein was mutated at amino acid position 129. Which of the following mutations will least effect…

A: All amino acids share different properties.

Q: Eukaryotic mRNA is modified by: A) Addition of a 5'-cap B) Addition of a poly-A tail C) Removal of…

A: Introduction  A ribosome reads messenger ribonucleic acid, a single-stranded RNA molecule that…

Q: the difference in primary structure between related tropomyosin informs arises from a) alternative…

A: The primary structure of proteins means amino acid sequence which is synthesized during the protein…

Proteins

We generally tend to think of proteins only from a dietary lens, as a component of what we eat. However, they are among the most important and abundant organic macromolecules in the human body, with diverse structures and functions. Every cell contains thousands and thousands of proteins, each with specific functions. Some help in the formation of cellular membrane or walls, some help the cell to move, others act as messages or signals and flow seamlessly from one cell to another, carrying information.  

Protein Expression

The method by which living organisms synthesize proteins and further modify and regulate them is called protein expression. Protein expression plays a significant role in several types of research and is highly utilized in molecular biology, biochemistry, and protein research laboratories.