Why do not all proteins have the same absorption coefficient (ɛ) at 280 nm? Pick one: a.lt is mainly due to the presence of Asp, Glu, Asn, Gln, Arg and His in the protein b.lt is mainly due to the presence of phenylalanine in the protein c.It is mainly due to the presence of tryptophans and tyrosines in the protein d.The statement is incorrect; all proteins have the same (ɛ) at 280 nm

Q: 4 of e flag Transcribe the following DNA: TACGGGGCTGAGATT Select one: a. UACGGGGCUGAGAUU O b.…

A: Transcription is the process by which genetic information encoded in DNA is used to synthesize RNA…

Q: 17 1 point E col bacteria, unlike most bacteria, can generate ATP through both anaerobic and eerobic…

A: Need to find the correct option from the given four options related to E.coli.

Q: 16. Eukaryotic initiation factor elF2B is a guanine nucleotide exchange factor. Explain why elIF2B…

A: The eukaryotic initiation factor elF2B is the guanine nucleotide exchange factor, which converts…

Q: Is liquid chromatography one of the current analytical methods in detecting porcine gelatin?Explain…

A: Yes, High Performance Liquid Chromatography is one of the current analytical methods in detection of…

Q: Table 2 Restriction endonuclease digest of genomic DNA Reaction components gDNA Hpall OR Mspl .…

A: Restriction enzymes These enzymes are proteins that have the ability to cleave the sequence of DNA…

Q: BIOCIHEMIOTRY. PRE-ACTI Q: Given that BSA has a molecular weightof S0,000 Daltons (9imol) please…

A: Given Values: Mol. wt of BSA = 80000 Dalton Weight if BSA = 10 μg The volume of water = 15 μl

Q: Which of the following enzyme is responsible for the regulation of biological nitrogen fixation? A.…

A: Nitrogen fixation is biochemical process by which molecular form of nitrogen with triple covalent…

Q: For the creatine kinase shuttle to be effective, the diffusion distance and the rate of ATP…

A: The enzyme creatine kinase is present in the heart, brain, skeletal muscle, and other organs. When…

Q: Need. help with c and d please, thank you!

A: The graph depicts the influence of glycosylation on the CD4 receptor on HIV infectivity in human and…

Q: 2. Describe the similarities and differences between Euglena and Scenedesmus? Describe the…

A: Differences  and similarities between Euglena and Scendesmus.

Q: 12. What are the steps in catabolism?

A: Catabolic process gives the chemical energy necessary for maintenance, and the growth of cells.…

Q: Explain the genetic advantage for the codon 5'-AAG-3' to code lysine and the codon 5'-AGG-3' to code…

A: Introduction Any of the 64 distinct DNA sequences of three consecutive nucleotides that either…

Q: Match the following organelles to their function or analogy. 1. The stores the DNA for the…

A: 1. Nucleus 2. Endoplasmic reticulum 3. Chloroplast 4. Golgi apparatus 5. Ribosomes 6. Cell wall 7.…

Q: Can you please answer 4 and 5

A: The correct answer for questions 4 and 5 is option (d) transcriptional control and option (d) 8…

Q: 2. Use the MRNA sequence to find the DNA sequence and the amino acid sequence. DNA MRNA-…

A: Nucleic acids are present inside the nucleus to store and pass genetic information and thus control…

Q: Select all the statements that correctly describe how to identify a mutant in E. coli. Check All…

A: It is critical that we understand microbes and their applications since they may be both useful and…

Q: 5. Using the scores in BLOSUM-62 matrix, and assuming the score of indel is -4, provide the score…

A: The term "indel" stands for "insertion/deletion", and it refers to the presence of gaps in the…

Q: GTTTTCACTGGCGAGCGTCATCTTCCTACT 5. Calculate molecular weight (kiloDalton, kD) and calculated pI…

A: Hi! Thanks for your question. As you have posted multiple questions, we are answering the first two…

Q: Give me a sample of backeted dichotomous key for identification of type of noodles

A: Introduction  Dichotomous keys are commonly used in biology and other sciences to identify and…

Q: Describe the process of converting adenosine tri-phosphate (ATP) into energy within the human bodyy

A: All living creatures use the tiny molecule ATP, that refers to adenosine triphosphate, as their…

Q: 1.Draw a single strand of DNA whose structure can have a 3-nucleotide sequence (codon) displayed on…

A: The DNA contains all the necessary information required for the formation of…

Q: Question 2 From the Pseudomonas aeruginosa plate, type below the numerical measurement (millimeters)…

A: Note: As Per Guidelines, We Are Allowed to answer one question at a time. So i am answering  Q2. And…

Q: You have cloned the gene for a human erythrocyte protein, which you suspect is a membrane protein.…

A: A hydropathy plot is a tool used to visualize the hydrophobicity or hydrophilicity of a protein…

Q: Can you help with q3 please, thank you.

A: The intermolecular interactions for the given active site of RNA is listed below . Explanation:Step…

Q: Study work, this assignment is not graded. Pratice

A: Problem 2(A)1. Approach to Solving the Question:Identify the asymmetric center (also known as a…

Q: ne assay. When cyclin D1 activates Cdk4 and Cdk6, the activated Cdks phorylate retinoblastima…

A: Polyacrylamide gel electrophoresis is the technique of separation of proteins on the basis of their…

Q: A new virus variant has a protein with the following amino acid substitutions: S25K, L72F, T931,…

A: Amino acids are the molecules of carbon, hydrogen, nitrogen and oxygen that contain one carboxylic…

Q: a. Porphobilinogen is a precuror to the biosynthesis of chlorophyll and many other biological…

A: Porphobilinogen is an organic compound that is found in living beings. It is basically an…

Q: 1. In a study by Cameroni et al. (Nature, Dec. 2021), scientists analyzed the interaction between…

A: SARS-CoV-2 is an infectious virus that is responsible for the recent COVID pandemic. It is a…

Q: The first two links of the chain of survival include phoning 911 and beginning CPR. Please select…

A: Basic Life Support are the essential algorithmic guidelines that are formulated by American Heart…

Q: This type of viral lifecycle(s) is displayed [Choose ] by the Lambda bacteriophage. [Choose ] Lytic…

A: The phage DNA enters the host cell by attachment and penetration during the lysogenic cycle. The…

Q: Please ASAP. Thank u. Mitochondria and chloroplasts have their own DNA but use the ribosomes of the…

A: Mitochondria are the powerhouse of the cell, as it generates adenosine triphosphate for completing…

Q: Cased by a muated allele. Individuals who have this disease cannot metabolise three amino acids…

A: p2 + 2pq + q2 = 1 and p + q = 1 According to Hardy weinberg principle p = frequency of the dominant…

Q: In flourscence, Excitation light, compared to emitted light, is Options O lower energy and shorter…

A: Introduction :- The emission of light by a substance that has absorbed light or other…

Q: In the protein whose primary sequence is provided below, which of the amino acids listed is…

A: Procarboxypeptidase B is an enzyme that catalyzes the removal of amino acid residues from the…

Q: Single digest - Cla I  What is the number of fragments? What are/is the size(s) of fragment(s)?

A: ClaI is a restriction endonuclease obtained from Caryophanon latum. Its recognition site is a…

Q: 1. Determine the ph of a 0.30 M NaH2PO4 and 0.20 M H3PO4 solution. pka is 2.16. А. 1.3 В. 2.3 С. 3.3…

A: 1. 2.3 When the moles of base added equals half the total moles of acid, the weak acid and its…

Q: Does transcriptional reporter with GFP allow you to see the expression of the different isoforms?…

A: Alternative splicing (AS) plays a fundamental role in the diversification of protein function and…

Q: Draw the morphological structure diagram for the word inexcusableness. (Note: There is only one…

A: Morphological Structure:  The study of words and their parts is known as morphology. Prefixes,…

Q: Definej tmess in your own word.

A: Health is essential to existence and requires the body and mind to be in excellent shape regardless…

Q: C. In order for your gel to run correctly, what side of the gel should you load the types of samples…

A: The technique of Gel electrophoresis is used or the separation of DNA fragments or macromolecules…

Q: 9. The following sequence is a wild-type bacterial gene that encodes a short protein. The sequence…

A: A) Lower Strand will act as template strand. B)5' ACUUCGAUAUGUCUAAAAUA 3'