Which of the following statements regarding mutation is FALSE?   Question options:   mutations can be caused by certain environmental agents     ALL of these statements are TRUE   mutations are usually lethal to the organism   mutations in somatic ells of multicellular organisms are not passed to offspring through sexual reproduction

Q: "Consider the arrangement of the following four normal chromosomes from some hypothetical organ…

A: Mutation is defined as any change in the DNA sequence of any organism. It can result due to error in…

Q: with an optimal rate of malt sugar conversion during fermentation. You are provided with the…

A: Introduction Metagenomics is the study of a set of genetic material from a mixed community of…

Q: Question 4 About endonucleases: A Restriction endonucleases always cut double-stranded DNA and are…

A: Nuclease is the nucleic acid digesting enzyme. Nuclease is of two types 1. exonuclease…

Q: Affected people are usually born to unaffected parents. Parents of affected people are usually…

A: 1. Autosomal recessive  2  X linked dominant  3. X linked recessive  4.  Y linked

Q: Imagine you are a cytogeneticist preparing a karyotype, but you forgot to add the colchicine in the…

A: The process of karyotyping occurs with the short-term culture of cells from the specimen. After a…

Q: Question 7. What is the sequence of the primary transcript produced from this gene? -35 sequence…

A: A gene is a segment of DNA that contains the necessary information for the synthesis of a functional…

Q: What is the difference between an operator and a promoter?

A: Replication is the process by which DNA makes identical copies. Transcription is the formation of…

Q: Polypeptide sequences are formed from 20 amino acids. What is the probability that a single point…

A: When a point mutation occurs, one of three things may happen:Due to the mutation occurring in a…

Q: Find a drug that is currently used in cancer treatment Tell me what it is used for (e.g. any…

A: There are many drugs that can be used to treat cancer which has action of targeting DNA…

Q: Question 1. What recruits the enzymes that form the 7-methylguanosine 5' cap on the transcript as it…

A: Primary transcript, also known as heterogeneous nuclear RNA (hnRNA), refers to the initial RNA…

Q: The lac repressor in bacteria and when lactose is present, the lac genes O Inhibits transcription of…

A: The lac repressor inhibits the transcription. In lactose metabolism, the lac operon is very much…

Q: Question -The FDA has authorized the use of direct-to-consumer testing for three mutations in BRCA…

A: The (FDA)Food and Drug Administration in the USA has authorized the Personal Genome Service Genetic…

Q: Suppose you are a lab technician who is responsible for diagnostic analysis of individual…

A: Thalassemia is a rare inherited disorder in which the body possesses lower-than-normal levels of…

Q: Please answer fast Place the steps for performing SNP-chip analysis in the correct order.…

A: SNP refers to single nucleotide polymorphism, in this the frequency greater than 1% in single…

Q: Question 4: Explain how a deletion mutation leading to a modification of the 3' untranslated region…

A: How a deletion mutation in the 3' UTR of CACNA1S mRNA could lead to hypokalemic periodic paralysis…

Q: How has regenerative medicine advanced in its ability to repair spinal cord injuries (SCI) with…

A: Spinal cord Injury- it is very debilitative disorder with minimum treatment.  The incidences of…

Q: You are teaching a class on the regulation of eukaryotic gene expression. In order to demonstrate…

A: Genes are the fundamental unit of heredity. They store genetic information in the form of DNA, which…

Q: QUESTION 25 What is the value of identifying prevalent base changes found in different cancer types?…

A: Cancer is a fatal disease that has both physical and mental consequences for a person. Cancer can…

Q: Please answer this quickly

A: The cells are of two types - prokaryotes and eukaryotes. Prokaryotes are primitive cells without any…

Q: 1. What is mutation? Explain the random and site-directed mutagenesis methods .Which one is…

A: Q1 a mutation is change in the sequence of the DNA or something which alters the genetic sequence of…

Q: What the gene product

A: Gene regulation in bacteria Introduction We tend to think of bacteria as simple. But even the…

Q: When or why is this genetic technology/process used? Who benefits from this genetic…

A: Recombinant genetic technology is the process of combining nucleic acid (DNA) of two different…

Q: Question 6. What are the first three amino acids in the protein that is produced from this gene?…

A: Genetic code exists in the form of codons and these codons are the sets of three nucleotides. There…

Q: Mutations can be classified as small-scale or large-scale, depending on the number of nucleotides…

A: a) change from CCGATG to CCGGATGThe sequence is altered from CCGATG to CCGGATG by the insertion of…

Q: Question 13. After electroporating 20 ng of your plasmid into bacterial cells and recovering the…

A: In question 13, out of the total 200 colonies, 150  colonies are white and 50 colonies are blue. So,…

Q: Why are host cell antiviral responses that target double-stranded RNA effective against single-…

A: The host cell's antivirus response against RNA viruses target enzymes used by RNA virusesto stop…

Q: Question 2. Which laboratory method can be used to quantify levels of all mRNAs expressed in samples…

A: RNA sequencing or RNA-seq is a powerful laboratory method used to quantify the expression levels of…

Q: uestion 17. Primers are designed to span introns or bridge an exon-exon junction to avoid genomic…

A: Reverse Transcriptase Polymerase Chain Reaction,l or RT-PCR is a frequently used method in molecular…

Q: Question 15 When you successfully inserted a gene fragment into the Hindill site and transform…

A: Genetic engineering refers to making desired changes in the genome of the organism. Transformation…

Q: 5. Consider the use of GWAS to identify mutations that contribute to an increased risk of pancreatic…

A: Cancer is a highly fatal disease that may occur due to the exposure towards high ultra violet rays.…

Q: 2. Justin: A CGT I I C. What is the sequence for this portion of Justin's p53 gene?

A: The Sanger sequencing use chain termination process because it use ddNTPs. When ddNTPs are…

Q: -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3'…

A:

Q: Remodeling complexes use the energy from ATPhydrolysis to change the position of…

A: Chromatin remodeling is the structural modification of chromatin to allow access of condensed…

Q: a.Explain the production of chymosin in a prokaryotic vector and the problems encountered in its…

A: Chymosin is also known as Rennin.  It is a proteolytic enzyme which is related to pepsin that…

Q: Shown below is the genomic structure of the wild-type gene for the human gene transthyretin. The…

A: Introduction: A nucleotide is an organic molecule that is the building block of DNA and RNA. They…

Q: Genes in the same species that have similar related functions are: a. paralogous b. orthologous c.…

A: The fundamental structural and operational component of inheritance is a gene. DNA is the component…

Q: Often a given mutation or variant will have slightly different phenotypes in different groups of…

A: Introduction : Sometimes a particular allelic variant can exhibit variable phenotype in different…

Q: Work in a small group or alone to complete this exercise. In Lab 2, Exercise 8, you determined the…

A: DNA ( Deoxyribonucleic acid ) is two stranded ladder like structure which act as genetic material in…

Q: (1)-Describe the three different methods of horizontal gene transfer among bacteria and mention…

A: INTRODUCTION Three different method of horizontal gene transfer Transformation, Transduction and…

Q: 11. Why does Vincent tell Irene. "You are the authority of what is not possible"? How does Vincent…

A: The concept of Gattaca is simple and brilliant: in the near future, genetic engineering enables…

Q: Describe an assay that could measure the activity of adenylyl cyclase (AC).

A: Introduction: Adenylyl cyclase (AC) is an enzyme that catalyzes the conversion of ATP to cAMP in our…

Q: Practice question 1D) In the boxes on the image, label the N and C termini of the çsRu protein. .…

A: The C terminal of protein has a carboxyl group free while the N terminal of a protein has one amine…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.