Both conservative and replicative transposition result in movement of the transposon; however, only conservative transcription Group of answer choices A. Transfers the transposition to the new location without copying it B. Has transposase that cuts at inverted repeats and target sequences C. Produces a second copy of the transposon sequence D. Inserts the transposon sequence into target sequences

Both conservative and replicative transposition result in movement of the transposon; however, only conservative transcription Group of answer choices A. Transfers the transposition to the new location without copying it B. Has transposase that cuts at inverted repeats and target sequences C. Produces a second copy of the transposon sequence D. Inserts the transposon sequence into target sequences

Name: Question 9Both conservative and replicative transposition result in mo
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Question 9Both conservative and replicative transposition result in movement of the transposon; however, only conservative transcriptionGroup of answer choicesA. Transfers the transposition to the new location without copying itB. Has transposase tha

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 14RQ: What processing step enhances the stability of pre-tRNAs and pre-rRNAs? methylation nucleotide...

See similar textbooks

Similar questions

QUESTION 14 What if you designed a CRISPR/cas9 assay for a gene knockout, but there's no PAM sequence immediately downstream of your target site. What happens? O It's fine because you put the PAM sequence in your guide RNA O PAM sequences only apply to real viral infections, not CRISPR assays. O The Cas9 nuclease won't cut at the target site O The guide RNA won't be complementary to the target O They'll be more off target effects but it'll still work.
Question 7. What is the sequence of the primary transcript produced from this gene? -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAG GCTATATTCACGTGGTACGCTA 3' 3' CTAAGGCATAATGTCGTATCCGATATAAGTG CACCATGCGAT 5' Start site Short Answer
Question 6. What are the first three amino acids in the protein that is produced from this gene? Write the amino acids using the three-letter code separated by a hyphen. -35 sequence Pribnow box 3' 5' GATTCCGTATTACAGCATAGGCTATATT CACGTGGATGGTCAGTA... 3' CTAAGGCATA ATGTCGTATCCGATATAAGTGCACCTA CCGATCAT... 5' Start site
please help with question 1 and 2.
Question 3 Review transcription. Match the term and its description. Each term can only be used once. RNA synthesis is catalyzed by this enzyme called | Choose ) The DNA sequence where RNA polymerase attaches is called | Choose | In bacteria, the sequence signaling the end of transcription is called | Choose J The stretch of DNA that is transcribed is called | Choose | These factors mediate the binding of RNA polymerase and the | Choose initiation of transcription > > >
Explanation
Question 32 What is the difference between an operator and a promoter? Edit View Insert Format Tools Table 12pt v Paragraph v B IUA 2 T?v T²
Do question 38
can you help me this answer properly just fllow the instructions and can you explain each of the problem
Question 1. What recruits the enzymes that form the 7-methylguanosine 5' cap on the transcript as it is converted to an hnRNA/primary mRNA?
please help with question a bit confusing
Please help me to answer the TRANSCRIPTION PROCESS: 1. Briefly describe the synthesis of mRNA in the transciptuon process 2. Write the base sequence for the mRNA that would be formed during transcription from the DNA strand with the base sequence GCCATATTG. Thank you very much for your help.