which of the following is true for methyl directed repair O A. methyl directed repair cannot distinguish the template strand from the newly replicated strand. O B. methyl directed repair changes both the template strand and the newly replicated strand. O C. methyl directed repair corrects the DNA strand that is methylated. O D. methyl directed repair corrects the mismatch by changing the newly replicated strand. O E. methyl directed repair corrects the mismatch by changing the template strand.

which of the following is true for methyl directed repair O A. methyl directed repair cannot distinguish the template strand from the newly replicated strand. O B. methyl directed repair changes both the template strand and the newly replicated strand. O C. methyl directed repair corrects the DNA strand that is methylated. O D. methyl directed repair corrects the mismatch by changing the newly replicated strand. O E. methyl directed repair corrects the mismatch by changing the template strand.

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

RNA primers are necessary in DNA synthesis because OA. primers mark the sites where helicase has to unwind the DNA. OB. the DNA polymerase enzyme can catalyze the addition of deoxyribonucleotides only onto the 3' (-OH) end of an existing strand. O C. RNA primase is the first enzyme in the replication complex. D. they are the source of nucleotides for DNA polymerases. 00 O E. DNA polymerase is unable to initiate replication without an origin. 5 p
DNA polymerase I functions in DNA replication to: O a. synthesize the RNA primer O b. O C. bind to single-stranded DNA and prevent it from reannealing O d. removes the RNA primers and fill in the gaps synthesize the leading and lagging strands synthesize the leading strand, but not the lagging strand e.
Which of the following mechanisms is involved in double-strand DNA repair? a. Homology-dependent repair b. Nonhomologous end joining c. Mismatch repair d. A and B e. A, B, and C
1. A short homologous sequence called the macrohomologies which connects break ends of the strands. a. True b. False Answer: 2. This type of DNA repair can recognize multiple damaged part in the DNA sequence and repair it. a. Nucleotide repair b. Strand break repair c. Base excision repair d. Base nucleotide replacement Answer:
Use the set of gene sequencing results below to answer the question that follows: A G C T -Wells I 14. Based on the sequencing results above, what is the sequence of nucleotides as they were added by DNA polymerase to the DNA template? a/ATC-GCA-GTA b. TAG-TGC-CAT c. TAC-TGC-GAT GC-GA TAG-CGT-CAT L A EI la la اد ان YI
RNA transcripts are formed in the A. 3' to 5' direction by the RNA polymerase reading the DNA template in the 3' to 5' direction B. 5' to 3' direction by the RNA polymerase reading the DNA template in the 5' to 3' direction C. 5' to 3' direction by the RNA polymerase reading the DNA template in the 3' to 5' direction D. 3' to 5' direction by the RNA polymerase reading the DNA template in the 5' to 3' direction
DNA polymerase is responsible for everything listed below except a. adding nucleotides in the 5' to 3' direction b. removing RNA primers c. reading the template in the 3' to 5' direction d. initiating DNA replication e. replacing the incorrect nucleotides with the correct one
Defects in the excision repair process may result in : A. Mutations B. Okazaki fragments C. Excess DNA polymerase activity D. Shortened telomeres
Nucleotide excision repair A. recognizes and repairs thymine dimers and other damaged bases in DNA B. corrects errors in nucleotide excision C. recognizes and removes mismatched bases after DNA synthesis is completed D. removes nucleotides that are incorrectly incorporated during DNA synthesis
Once bound to the promoter, RNA polymerase O a. melts the two DNA strands in the termination site region O b. degrades the two DNA strands in the start site region O C. separates the two DNA strands in the start site region O d. chemically alters the DNA template O e. breaks the DNA chain in the start site region
Q1: Summarize how DNA repair works and why the repair mechanisms are essential for the normal function of cells and whole organisms. Q2: Is DNA repair 100 percent effective? Q3: What would happen to an organism if its DNA repair became less effective?
If you have got the following DNA template molecules, which one of them will require more energy to break down the hydrogen bonds between the antiparallel strands? O a. ATATATATCGCGTTAAATTCTA O b. AAAAAATTTTTCCCCCGGGGG O c. GGGGGCCCCCAATTCCCCCCC O d. TACТАСАСTGTGGTTААТТААA O e. GCGCGCGCGCGCGCGCGCGCG ype here to search Chp