Which of the following statements are true? I. Oncogenes isolated from a human tumor can transform mouse fibroblasts II. Mouse fibroblasts can be transformed by transfecting them with a single oncogene III. Human fibroblasts can be transformed by transfecting them with a single oncogene A. I and III B. III C. I, II and III D. II E. II and III F. I G. I and II

Q: The drug pump activity of Cancer stem cells can be explained by the overexpression of: a. Mdr1 b.…

A: Cancer is the state of uncontrolled cell division.

Q: Which of the following describes an oncogene Group of answer choices A. a gene that stimulates cell…

A: Cancer is caused by changes in the DNA and is called genetic changes. Cancer is the growth of the…

Q: What is the map distance between the two rapid lysis mutations re and r' given the data below? 2…

A: In the question given that, re- rf- X r+ Large plaques= 5200 Small Plaques= 4800 Out of the total…

Q: ms in Column A with most related ones in B. Write the letters on the space provided.

A: Flavr Savr>inhibitor gene Bt eggplant/ Bt corn> Selective Toxicity

Q: a way in which proto-oncogenes can change to become genes that induce cancer?

A: A proto-oncogene is a normal gene that can turn into an oncogene due to mutations or increased…

Q: Defects in this gene have been associated with metastasis in pancreatic cancer. Select one: O a. APC…

A: Answer : Option "G" is correct - BRCA1

Q: please help with these two questions: 1.De novo gene expression is concentrated in the colon…

A: Infanticide   Infanticide is the killing of newborn.

Q: Developing B cells that fail to make productive D to J heavy-chain rearrangements on both homologous…

A: B cells get matured in the bone marrow or in the lymph node. Mature B cells express antibodies on…

Q: Which of the following statements about epigenetics is correct? 1. Twins have identical epigenetic…

A: Epigenetics is the study of heritable changes in gene expression that do not involve changes to the…

Q: Which of the following might explain why some individuals lack the ability to make enough T-cells?…

A: T-cells are generally one kind of lymphocyte and one of the crucial parts of white blood cells.…

Q: Retroviruses such as HIV, Herpesviruses, and Hepatitis B can be effectively inhibited by _____. Mark…

A: Nucleoside analogs such as acyclovir are antiviral drugs that can effectively inhibit the…

Q: What growth factor would be needed in the liver for both type I and type 4 cancers to grow? Tissue…

A: Cancer  It is a condition of an organism where any body cell divide abnormally and very fast which…

Q: A. What do scientists do to adult cells to make them “behave” like embryos?  B. Transgenic, cloned…

A: The embryo is formed from the fusion of the male gamete and the female gamete in the process of…

Q: + + T | + + 1 = + T +||| + 2 +11 + 1 + + 1 + + + 1 + + + + 3 4 5 + + I 9 9 5 U 4 m N 1 + - - + + + +…

A: Given here are point mutattions and the correct order is as follows.

Q: 47. hTERT is repressed in these cells: A. Germ cells B. Tumor cells C. Somatic cells D. A and B

A: hTERT is represses in the cells.

Q: Which of the following statements about epigenetics is correct? 1. Epigenetic drugs could be…

A: Genes are the energy currency of the organisms. These genes are present in the DNA of the cells.…

Q: 1. Compare the consequences of a mutation that occurs in the Ras proto-oncogene and a mutation that…

A: Mutations in key genes can have profound effects on cellular processes, particularly when they…

Q: Which of the following statements about epigenetics is correct?         1. Epigenetic drugs could be…

A: Epigenetics are the changes in gene expression.

Q: Which of the following is NOT a genetically engineered animal? Lütfen birini seçin: O a. Sheep…

A: Most of the options given above are animals produced trans-genetically.  Transgenetic animals are…

Q: Mutations to proto-oncogenes act toa. increase cell division. c. repress oncogenes.b. increase DNA…

A: Cancer-critical genes are categorized into classes; Proto-oncogenes and Tumor-suppressor genes. The…

Q: What are the characteristics of stem cells? (Select ALL that apply)

A: Stem cells are of two types. The embryonic stem cells which are derived from embryos. The other…

Q: What is/are product(s) from commensal bacteria that regulate the expression for ler, regulator of…

A:

Q: Answer the following multiple-choice questions about cancer-promoting mutations. A gene whose…

A: Cancer cells by definition, proliferate in defiance of normal controls and are able to invade and…

Q: Oncogenes:    A. Are dominant.  B. Cause cells to divide uncontrollably.  C. Are mutations of Proto…

A: Cancer is a disease which is caused by the uncontrolled growth of the cells, without regulation of…

Q: 8. Which of the following is a proto-oncogene? Select all that apply. a. Abl b. Ras c. Myc d. Bax

A: Oncogenes are genes that have the potential to cause cancer. They are mutated forms of normal genes…

Q: VHL is a tumor suppressor because     a. it causes cancer cells to become hypoxic     b. it…

A: Tumor is a mass or lump that results from the abnormal growth of cells in the body. A tumor…

Q: Humans with defective expression of the integrin LFA-1 have an immunodeficiency disease…

A: Introduction : The ability of the body to defend against pathogens is referred to as immunity. It…

Q: Match the gene on the left with the gene category on the right.…

A: Genes  Genes are the information coded in a DNA. They make our protein and enzyme. They are…

Q: Genetically modified foods may contain high amounts of essential vitamins and minerals; however,…

A: Genetically modified foods (GM foods), also known as genetically engineered foods (GE foods) or…

Q: The first mutation is thought to occur in utero in most cases of ALL diagnosed before age 5 years…

A: Acute Lymphoblastic Leukemia (ALL) is a type of blood cancer that affects white blood cells. It is…

Q: Targeted therapies are used in patients with a set gene expression pattern. A targeted therapy that…

A: Targeted therapies also called molecular targeted drugs for treating cancer involve drugs and other…

Q: Alterations in which of the following intracelluar pathways appear to be required for human cell…

A: <!--<SUB-PART>--> (a) <!--<SUMMARY-INTRODUCTION>-->   To Determine: If the…

Q: Hypermethylation is thought to contribute to cancer by a. inhibiting DNA replication. b. inhibiting…

A: DNA methylation is one of the intensely studied epigenetic modifications in mammals. The regulation…

Q: Humanized monoclonal antibodies are best described as a. antibodies made in mice in which the…

A: Ans: The antibodies generated in the laboratory that specifically binds to single epitope or antigen…

Q: 15) Cancer-predisposing genes may: a. Enhance the host’s immune ability to recognize and eradicate…

A: Cancer is a condition in which the cells undergoes continuous cycle without stopping and doesn’t…

Q: #6) Histological work suggests that colon cancer develops in a multistep fashion. Which of the…

A: ANSWER) (5) a, b and c Colonoscopy is the medical procedure for detecting the abnormal changes in…

Q: PLEASE MAKE SURE THE STATEMENT IS TRUE OR FALSE  A) Regarding hereditary elliptocytosis (HE):  A. It…

A: Hereditary elliptocytosis is a condition where the RBCs are irregularly shaped and this disorder is…

Q: 1. Nutritional Genomics is the term used to describe: a. How nutrients affect gene expression b. How…

A: Nutrigenetics is a newly developing field where the "we are what we eat" idiom will get an entirely…

Q: What is the map distance between the two rapid lysis mutations re and rf given the data below? 2…

A: Hint: Always less numbered progeny becomes recombinants. In the question given that, re- rf- X r+…

Q: Why is gene therapy a successful treatment for Leber congenital amaurosis (LCA)? A The immune system…

A: Leber congenital amaurosis is a congenital disease caused by the inheritance of mutated RPE65 genes.…

Q: . Define the following terms:a. chaperone-mediated autophagyb. microautophagyc. macroautophagyd.…

A: Introduction: Autophagy is the cell's standard, regulated mechanism for removing unwanted or…

Q: 5. PDGF is overexpressed in certain cancers. This is an example of a mutation in the --- region. a.…

A: INTRODUCTION Answers of question 5&6 is given below.

Q: Most forms of cancer involvea. the activation of a single oncogene.b. the inactivation of a single…

A: The medical condition of cancer is characterized by the abnormal growth pattern of the cells…

Q: A. DNA viruses generally cause malignancy by : inserting themselves in the host DNA, possible…

A: Mutations are a sudden heritable change in the sequence of DNA/RNA that corresponds to altered amino…

Q: Mutations within this gene CAGATTGTGAAGAGGTCTCTTGA are causative of which human diseases? A.…

A: The nucleotide sequence provided corresponds to the XPA gene of humans. This is deduced by doing a…

Q: An oncogene is produced from a                   that has acquired a                      .a.…

A: Cancer is an abnormal condition that leads to proliferation of normal cells. They are caused due to…

Q: 4 ______________ studies revealed that some mRNA molecules are formed by splicing pre-mRNA.…

A: 4 ______________ studies revealed that some mRNA molecules are formed by splicing pre-mRNA.…

Genomic studies

Genomic studies (genomics) is the study of the whole genome of an organism. Using bioinformatics and high-performance computing, genomic researchers examined massive amounts of deoxyribonucleic acid (DNA)-sequence data to discover variations or mutations that affect drug response, health, or disease. Genomics is a much younger discipline than genetics, having only emerged in the last few decades as a result of technological advancements in DNA sequencing and computational biology.