Which of the following is likely to be transcriptionally expressed? euchromatin and DNA with methyl groups euchromatin DNA with methyl groups DNA with acetylated histones euchromatin and DNA with acetylated histones
Q: Consider Molecule X, which is found in all living cells. This molecule is transcribed from a stretch…
A: DNA is a biomolecule present in the eukaryotic nucleus. It is made up of nucleotides.
Q: How do dietary factors interact with DNA methyltransferase to affect an organism's phenotype in an…
A: The modulation of gene expression via processes other than the DNA coding sequence is referred to as…
Q: In eukaryotic chromatin, tightly coiled scaffolding proteins would indicate a region where genes are…
A: The chromatin structure of the DNA includes the long helical structure of the DNA and the histone…
Q: NA beig sis is a compicated pro cids. Complete the DNA-to-amino acid table for three consecutive…
A: Introduction DNA is a self replicating molecule. mRNA is produced from DNA by a process called…
Q: Replacement of histones with variant histones will cause an increase in the compaction of the gell…
A: Answer: Histone : These are the Octameric proteins around which DNA winds to form a structural unit…
Q: Histone tails can be modified to change the shape and "tightness" of the nucleosomes. Acetylated…
A: Histone acetylation is the process of transfer acetyl group(functional group) to particular histone…
Q: Given the following stretch of mRNA, what would be the sequence of the corresponding non-template…
A: DNA stands for deoxyribonucleic acid. It is the genetic material of cell.
Q: a. Indicate whether point C is a 5' end or a 3' end of a nucleic acid. b. Indicate which strand…
A: The ribonucleic acid was the primary genetic material. It acts as a genetic material furthermore as…
Q: Which statement is FALSE? Group of answer choices Histones are very conserved at the primary…
A: 2nd statementis false. H1 doesn't contain histone fold domain. H2A, H2B, H3 and H4 have HFD
Q: Examine the following sequence of DNA 3’-CTA – TAC – TTA – CGC – GTA – CAT – GCG – TGA – CCC - ACG –…
A: The central dogma is a metabolic process where the DNA acts as genetic material and transcripted…
Q: segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following…
A: For protein synthesis, messenger RNA must be made from one strand of DNA called the template strand.…
Q: Indicate which of the following items are associated with transcription or translation. This could…
A:
Q: Lactose intolerant individuals do not produce the enzyme lactase. Studies show that the gene that…
A: Lactose sugar is obtained from milk products and milk. When people do not produce enough lactase…
Q: cell is homozygous for a LOF mutation in the histone acetyltransferase (HAT) gene. Which of the…
A: HAT stands for Histone acetyl transferase. The LOF refers to the loss of function mutation. If a…
Q: Match the type of chromatin modification with the most likely effect on gene expression near the…
A: DNA and histone proteins, which are essential elements of the chromatin structure, are chemically…
Q: elow is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…
A: DNA and RNA are the genetic material which have the genetic information about perticular organism…
Q: Which of the following are involved in transcription? O RNA polymerase DNA amino acids TRNA acetyl…
A: In translation mRNA, tRNA, rRNA, Amino acids, ribosome, acetyl transferase are required.
Q: Chromosomes core of 8 are composed of 1. forming a structure called a chromatin; DNA; histones;…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA…
A: The core dogma notes that the sequence of learning most commonly found in our cells is: From…
Q: Dystrophin is a protein that forms part of a vital protein complex that connects the cytoskeleton of…
A: Genetic Disorders are disease conditions in the body that occur as a result of gene mutations or…
Q: A region of a eukaryotic chromosome that is gene-rich (i.e. contains many genes) would be expected…
A: The presence of a membrane-bound nucleus is the primary feature that distinguishes a eukaryotic cell…
Q: Drag the term or statement to the correct column. Transcription factor stimulates own production…
A: Epigenetics is the study of heritable phenotype changes. It does not involve alterations in the DNA…
Q: One strand of DNA reads T-A-C-G-A-G-C-T-C. Describe the steps of protein synthesis of a eukaryotic…
A: DNA is the genetic material in living organisms. It carries instructions for making structural and…
Q: Which of the following most accurately describes the process involved in protein synthesis?…
A: Introduction The decoding of an mRNA message into a polypeptide product is known as translation in…
Q: A plant geneticist was examining the inversion mutation XI 501 in barley where a segment of DNA is…
A: Any alteration occurring in the DNA sequence of an organism is known as mutation.
Q: Ac
A: The fundamental physical and functional unit of heredity is the gene. DNA is the material that makes…
Q: An enzyme is needed for the Krebs Cycle. It will be made following the directions contained in a…
A: In eukaryotes, the genetic information needed for all cellular processes is encoded by genes, which…
Q: Which of the following is a type of chromatin remodeling? the changing of amino acid sequence of…
A: The DNA double helix is firmly wrapped around nuclear proteins called histones in the cell nucleus.…
Q: Which of the following does not contribute to preserving the memory of identity in a dividing cell?
A: It is important for a dividing cell to preserve its identity so that it can be correctly…
Q: if the following DNA sequence were transcribed, which of the following describes the output of this…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…
A: Central dogma refers to the process by which information stored in a DNA molecule is converted into…
Q: gene expr yotic cell. Which of the following is true for transcription in this cell? Select all that…
A: Gene expression is the process by which information present in the genes are decoded to produce…
Q: Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and…
A: FGF3 gene is responsible for producing a protein called fibroblast growth factor 3 which is a part…
Q: The following DNA sequence is found on a chromosome in rice plants: 5’…
A: Given DNA sequence: 5’ ACCTTGCTCACATGTGGCGTACCTTTCCGTCTATCTGAACAC 3’ Since, this is the…
Q: A scientist observing a cell during gene expression would be able to easily distinguish it as a…
A: Answer-- option 1- 0 The genotype of II-5 will be ww.
Q: There are two ways in which rearrangement of domain- encoding gene segments can result in novel…
A: Introduction Prokaryotes: These are the organisms which have characteristic nucleoid rather than…
Q: The accuracy of transcription is less than the accuracy of DNA replication. The error rate of…
A: Replication is the process which is responsible for synthesis of DNA from the parental strand of…
Q: Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and…
A: DNA stands fo deoxyribonucleic acid. It is the genetic material.
Q: The following sequence of DNA is part of the normal, wild-type gene. 5'TAC CGG GAC TTG AGC CGA…
A: A single nucleotide from the DNA is deleted in nucleotide deletion. Although the single nucleotide…
Q: 6) There is clear evidence that chromatin state is directly related to the ability of proteins to…
A: The chromosomes appear as a mass of greatly fine tangled string called "chromatin." Chromatin is…
Q: Nucleosomes are: O essential for the correct regulation of eukaryotic gene expression. O All of…
A: Solution)All of these answers are correct.Nucleosomes are composed of DNA and proteins, specifically…
Q: Why would it be impossible for DNA splicing to occur utilizing the same mechanism as eukaryotic MRNA…
A: RNA splicing is a kind of RNA processing in which a newly made precursor-mRNA is transformed into a…
Q: asic amino acids including lysine. DNA and histones collectively form chromatin. Open open and…
A: Histones can be defined as the family of basic proteins that are associated with the DNA in the…
Q: Unlike in prokaryotic cells, transcription and translation in eukaryotic cells... Group of answer…
A: DNA is a polynucleotide strand that consists of a large number of nucleotides. Nucleotides consist…
Which of the following is likely to be transcriptionally expressed?
euchromatin and DNA with methyl groups |
||
euchromatin |
||
DNA with methyl groups |
||
DNA with acetylated histones |
||
euchromatin and DNA with acetylated histones |
![](/static/compass_v2/shared-icons/check-mark.png)
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- Which of the following statements concerning eukaryotic chromatin is true. Histones have an overall negative charge. Euchromatin is more condensed then heterochromatin. After replication nucleosomes are made up of a mixture of old and new histone proteins. Euchromatin is associated with the centromere and telomere regions. Heterochromatin are regions of active transcription.Histones contain many basic amino acids including lysine. DNA and histones collectively form chromatin. Open chromatin is much more open and accessible to the transcriptional machinery than closed chromatin. Histone lysine acetylation is associated with open chromatin and occurs near genes that are being actively transcribed. Part A Given what you know about the chemical properties of DNA and the function of histones. whv do histones contain so many basic amino acids? Answer in no more than two sentences. Part B Given what you know about how acetylation affects lysine, why does histone lysine acetylation open chromatin? Answer in one sentence only.Typically, increased acetylation and decreased methylation of histone N-terminal tails in nucleosomes leads to removal of the protein components of the chromatin from the DNA relaxed packaging of the chromatin and increased transcription increased amounts of euchromatin relative to heterochromatin activation of topoisomerase tighter packaging of the chromatin and reduced transcription
- If a section of a chromosome is heavily methylated, which of the following is likely to be true? Group of answer choices That portion of the chromosome is transcriptionally active That portion of the chromosome consists of euchromatin That portion of the chromosome is transcriptionally quiet RNA polymerase will have easy access to the DNA in that regionHeterochromatin and Euchromatin Have Which Different Histone modificationsThe following image shows the 'beads-on-a-string' model of DNA and the effects of histone modification on chromatin structure. What effect does histone acetylation have on Gene 1? Gene 1 De-acetylation Acetylation Ac Ac Gene 1 Ac Ac Ac O Acetylation increases expression of Gene 1 O Acetylation decreases expression of Gene 1 O Acetylation causes a mutation in Gene 1 O There is no way to tell from this figure
- Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?Compared to heterochromatin, euchromatin is comprised of densely packed nucleosomes and with higher transcription activity comprised of densely packed nucleosomes and with lower transcription activity O comprised of loosely packed nucleosomes and with lower transcription activity Ocomprised of loosely packed nucleosomes and with higher transcription activityDiscuss the levels of chromosomal organization with reference to the following terms: a. nucleotide b. DNA double helix c. histones d. nucleosomes e. chromatin
- In studies on chromatin it has been reported that DNA that is being actively transcribed is more sensitive to digestion by DNase I. Which of the following events is known to make DNA more sensitive to digestion by DNase I? Formation of heterochromatin DNA methylation All of the provided answers are correct. Acetylation of histone O Deacetylation of histoneYou have discovered a new species of plant. You isolate chromatin from the plant and examines it with the electron microscope and see characteristic beads on a string structure. After addition of a small amount of nuclease, which cleaves the string into individual beads that each contain 280 bp of DNA. With more digestion a 120-bp fragment of DNA remains attached to a core of histone protein. Analysis of the histone core reveals histones in the following proportions: H2A 33.3% H2B 33.3% H3 0% [no histone H3 found] H4 33.3% Based on these observations, what conclusions can you make about the probable structure of the nucleosome in the chromatin of this plant? Be specific in describing the nature of the nucleosome: which histones form the core (), how many of each are present () and size in bp of core-DNA that envelopes it ().Which one of the following statements is NOT true of histones? O They are involved in the packaging of eukaryotic chromatin. O They are highly conserved. O They are positively charged. They contain high amounts of arginine and lysine. O DNA double-wraps around seven histone proteins.
![Human Heredity: Principles and Issues (MindTap Co…](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
![Human Heredity: Principles and Issues (MindTap Co…](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)