Which of the following allows the AIDS virus, which contains RNA to insert viral DNA into the DNA of a host T-cells after the AIDS virus enters the cells?

Q: Which of the following are features of secreted bacterial proteins? (SELECT ALL THAT APPLY) A…

A: The question is asking about the features of secreted bacterial proteins. Secreted bacterial…

Q: Which enzyme removes a phosphate from the 5' end of the MRNA, leaving two phosphates?

A: mRNA is a messenger RNA, it is a single stranded RNA which carries the genetic sequence of the DNA…

Q: Which of the following statements about RNA are true?

A:

Q: Which of these choices does NOT explain why RNA is less stable than DNA? O The 2' hydroxyl group…

A: There are two types of genetic material in organisms: DNA RNA

Q: Which of the fokmang the first event to take place in A base pairing of activated methionine-IRNA to…

A: Transcription is the process of making RNA copy of DNA. Translation is the process of making…

Q: Viruses are nonpolar due to their lipid membrane. Water is polar. Soap is a surfactant, which means…

A: Viruses contain nucleic acid in the core region while exterior/ envelope is made up of a…

Q: sigma factor: promoter as O protein: DNA O mRNA: tRNA -35 element: GATCC element O elongation:…

A: Transcription is the process of making an mRNA copy of a gene (DNA). It is catalyzed by an enzyme…

Q: Chapter 17: If given the following coding strand of DNA, what is the MRNA? What TRNA will be…

A: There are two types of nucleic acids present in the cells- DNA and RNA. DNA carries the genetic…

Q: The structure below is a fragment of what molecule? NH₂ NH, OP.OCH, OPOCH, oroc, QPOCH, O DNA ORNA O…

A: There are two kinds of nucleic acids DNA and RNA. DNA is double started molecules and RNA is a…

Q: Which protein of ß galactosidase includes a MCS? Alpha fragment 'lac z gene '2lacz gene 'lacz3gene

A: Lac Z gene is found in the MCS. MCS stands for multiple cloning site. This site is responsible for…

Q: .  Which ONE of the following action would be most selectively toxic against bacterial cell? Group…

A: you have asked multiple questions and according to our guidelines we are instructed to answer only…

Q: Transcribe, and Translate from the following DNA segment: DNA:    TAC AGG CTG GAT TTA ATC mRNA:…

A: Central dogma of molecular biology involves transcription and translation. Transcription is the…

Q: B

A: The plasma membrane of a cell comprises of different kind of proteins.they are mainly categorised…

Q: When amino acids are scarce in that bacterial cell, there are tRNAs without carrying lysine gets to…

A: DNA and RNA are the major genetic information carrier in cells. DNA is converted to RNA and RNA is…

Q: What are ribosomes composed of? tRNA & proteins mRNA & tRNA rRNA & proteins  mRNA & proteins…

A: The ribosomes are composed of two subunits a smaller and a larger and the sizes of prokaryotic and…

Q: The process of transcription and translation help to crate which type of macromolecules

A: Given: To find which macromolecule is produced during the process of transcription and translation…

Q: Which of the following is a function of SRP?a. Pausing translation of polypeptides with an ER…

A: Protein synthesis occurs in cytoplasm by ribosome. Different protein have different destination such…

Q: If you wanted to study a newly discovered ion channel from a bacterium in isolation from other…

A: Approaches have made their way into the field of C. elegans, a model organism that has been used for…

Q: TRNA * Carries amino acids in the cytoplasm to ribosomes for protein assembly Amino Acid attachment…

A: The correct answer is (b) amino acid attachment site across from anticodon site on tRNA Transfer…

Q: The function of a gene is dictates the primary structure of a protein dictates the nucleotide…

A: Proteins :  Primary structure of proteins is the sequence of amino acids in a polypeptide chain.…

Q: RNAi takes place in... nucleus cytoplasm both

A: Both

Q: How many ribosomes can bind an mRNA molecule and translate into a protein at the same time?

A: The m RNA formed at the end of the Transcription will move on to the cytoplasm for the translation…

Q: DNA: AGA ACA TAA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GAC…

A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…

Q: Match the class of yeast mutant with a possible loss of function mutation in a specific protein. v…

A: The yeast mutants have been classified into five classes: Class A- Transport into ER doesn't work…

Q: What type of cytopathic effect is seen when rabies virus infects a monolayer of cells? O the…

A: The cytopathic effect of the rabies virus on a monolayer of cells is characterized by the formation…

Q: What happens immediately following uncoating of a minus strand RNAvirus? O Transcription of MRNA…

A: This is majorly found in some viruses , where uncoating is found that means genome is completely…

Q: Which part of the ribosome in bacteria, forms the catalytic site for peptide bond formation?  16S…

A: Gene is a hereditary units which is exhibited on the chromosome . Gene expression is a phenomenon in…

Q: 32. What are the two components of tRNA which are important for building a protein? what are…

A: The tRNA is responsible for transferring amino acids to the ribosome at the site of translation.…

Q: TRANSLATION

A: Central dogma: This theory states that the DNA contains instructions for making a protein which are…

Q: If Sar1 is inserted into the ER membrane: O It is bound to GDP and recruits COPII coat proteins O It…

A: Sar1 is a small GTPase that plays a key role in the formation of COPII vesicles, which transport…

Q: Here is the complete mRNA sequence from a bacterial cell: 5'…

A: In protein synthesis, the process of translation converts the sequence of the mRNA (messenger RNA)…

Q: Body Covering: DNA: GGGAGTGTATACGGGATGAAGGCGATT MRNA: 12 protein: phenotype:

A: To make proteins transcription happen, which mean DNA(genes)>copy of gene>protein, this is the…

Q: Below which statement is correct? RNAS do not possess catalytic capabilities or modified nucleotides…

A: Answer is 4th statement is correct

Q: Where does the transcription occur? Where does transition occur?

A: The answer given is in correspondence with translation instead for transition. We assume that to be…

Q: Which proteins are required for RNA synthesis? Helicase Primase Sigma factor Ligase RNA…

A: Transcription is the process that transcends the gene information present on DNA into mRNA. It means…

Q: The ribosome catalyzes the formation of peptide bonds. Which of the following statements is false?

A: The ribosome employs entropic catalysis to accelerate peptide-bond formation by positioning…

Q: What is the predicted function of the Duffy gene? O Cell Adhesion Molecule O Microfilament RNA…

A: Gene is the basic structural and functional unit of heredity. A gene exists as two alternative forms…

Q: An RNA which has a functional group that allows to act as a catalyst a generally caled A SRP B snRNP…

A: Enzymes are biocatalysts. Enzymes speed up the reaction.

Q: 4. Illustrated below is the parts of SARS-CoV-2 virus. Search for the FUNCTIONS of the ff…

A: Severe Acute Respiratory Syndrome Corona Virus 2 (SARS-CoV-2) is a RNA virus belongs to the family…

Q: The information contained in the sequence and structure of a protein can Be used to synthesize RNA…

A: The information contained in the sequence and structure of the proteins can be used to…

Q: Which of the following statements regarding RNA is NOT true RNA is predominantly double stranded O…

A:

Q: A. Determine the MRNA codons, tRNA anticodons, and amino acid chain that will be produced from the…

A: Cell is an elemental unit of the body in which metabolic activities takes place .  It comprises of…

Q: Which is FALSE about the protein that regulates tryptophan biosynthesis? O The recognition helices…

A: Tryptophan is an essential amino acid. Thus, it is obtained through the diet. In plants, the amino…

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.