Which line or lines represent(s) bags that contain a solution that is hypertonic at the end of 60 minutes? Mass Change (%) 65432 012345 10 20 30 40 50 60 Time (minutes) AB 0 D E Five dialysis bags, constructed from a semi-permeable membrane that is impermeable to sucrose, were filled with various concentrations of sucrose and then placed in separate beakers containing an initial concentration of 0.6 M sucrose solution. At 10-minute intervals, the bags were massed (weighed) and the percent change in mass of each bag was graphed. A and B B E and C D and E E
Q: Which of the following is a function of the right hemisphere of the brain?…
A: The human brain is divided into two hemispheres, the left and the right, each performing a variety…
Q: Fiyona Biomagnification Through a Food Chain Purpose: You will use M&M candies to model…
A: Explanation:This simulation demonstrates the process of bioaccumulation and biomagnification. At the…
Q: Open documents with docReader X 3 Listen Question 3 Determine the confidence interval (%) if there…
A: A confidence interval is a range of values, derived from a statistical calculation, that is likely…
Q: Biology B Tutorial Seven- Nervous and Endocrine System Tutorial 7 (Week 10) - Nervous and Endocrine…
A: Question 1: Identification and Role of Neuron PartsDendrites: These are branch-like structures that…
Q: Answer in step by step with explanation. Don't use Ai. Answer in all options. Answer in 100% human.
A: Altruistic behavior is when a person assists others without any expectation of getting something…
Q: Answer in step by step with explanation. Don't use Ai and chatgpt. Answer in all options provided.
A: The Park Grass experiment, one of the longest-running ecological experiments, was conducted to study…
Q: Why would an organism benefit from being able to perform both aerobic and anaerobic respiration? In…
A: Aerobic respiration is a process that requires oxygen to break down glucose and produce energy in…
Q: Question 4 Describe Mechanism and give full answer of this question and don't use chatgpt otherwise…
A: Penicillin resistance occurs when bacteria develop the ability to survive and multiply in the…
Q: Explore the positive and negative impacts of Zomedica's TRUFORMA on individuals and groups from the…
A: Zomedica's TRUFORMA is a diagnostic platform designed to assist veterinarians in the detection of…
Q: What skin layer can I only find in thick skin? What is the most superficial layer of the epidermis?…
A: 1. Stratum Lucidum in Thick Skin: The stratum lucidum is a thin, clear layer of dead skin cells…
Q: Gamma-amino butyric acid and serotonin are widely used neurotransmitters. In general, pharmaceutical…
A: Neurotransmitters are chemicals that transmit signals from a neuron to a target cell across a…
Q: Answer in step by step with explanation. Don't use Ai and chatgpt.
A: The enzyme responsible for light repair, also known as photoreactivation, that splits thymine dimers…
Q: Does the insertion normally move towards the origin, or does the origin normally move towards the…
A: Question 1:Does the insertion normally move towards the origin, or does the origin normally move…
Q: Following the brief descriptive style we employed in class for Vitamin B12-utilizing enzymes,…
A: Step 1: Step 2: Step 3: Step 4:
Q: a) What do the authors say is known and not known about the genetics of butterfly wing patterns? b)…
A: There are both known and unknown aspects of the genetics of the butterfly wing pattern.The authors…
Q: can you make a book similar to this on bookcreator but make it about the stages of the plant cycle…
A: Photosynthesis is a fundamental biochemical process in plants, algae, and some bacteria, where light…
Q: 1. What was the ecological significance of the evolution of photosynthesis? 2. Why might…
A: 2. Hydrothermal Vents: Clues to the Origin of LifeHydrothermal vents, particularly deep-sea alkaline…
Q: Which of the drugs below cause CNS side effects a. Antibiotics b. Platelet-inhibiting drugs c.…
A: The question is asking us to identify which of the given drugs can cause side effects related to the…
Q: 1. Using the schematic on the right, which section (A or B) will exhibit the highest osmolarity…
A: In the kidney, the renal medulla (section B) will exhibit the highest osmolarity. This is because…
Q: 3. In cats, the gene for fur length has two alleles, L and 1. Cats with the genotype ll have long…
A: Refer to the solution
Q: Draw a spinal section.• Shade in the parts containing grey matter• Leave the parts containing white…
A: A. Dorsal direction (shown by red arrow)B. Ventral direction (shown by red arrow)
Q: What is the electric field at point A in the figure if d = 2.10 m, R = 0.500 m, 91 = 19.0 nC, and 92…
A:
Q: #29
A: Detailed explanation: Part A: Explain the ResultThe breeder crossed a yellow Labrador male and a…
Q: Please help answer
A: Approach to solving the question: Detailed explanation: Examples: Key references:
Q: What's the number of species of chirdates
A: Approach to solving the question: Detailed explanation: Examples: Key references:
Q: In another question, you explained the classical monocot leaf pattern. However, in this life…
A: Both Poa pratensis (Kentucky bluegrass) and Zea mays (maize or corn) belong to the angiosperm group…
Q: The replication bubble shown has a number of RNA primers (blue) bound to the two strands of the…
A: DNA replication is a biological process that occurs in all living organisms and copies their DNA; it…
Q: GENETICSIn families of 6 sibships, the probability of obtaining 3 boys and 3 girls is?Show formula…
A: The problem is asking for the probability of a family with 6 children having exactly 3 boys and 3…
Q: t numbers of endangered Species in California's 4. The data in the table below show the percent…
A: Instead of different colors, you can draw different patterns in bar to distinguish between them, if…
Q: Given the following sequence on the coding strand of prokaryotic DNA, provide all of the following…
A: Answer:DNA Template Strand: 3' TACGCTGATCCAAACGGCCTACCTAC 5'mRNA: 5'…
Q: Routes of Drug Administration are how drugs get into the body. Compare 4 different routes of drug…
A: Oral administration is the most common route of drug administration. It involves swallowing a drug…
Q: Describe the visible differences between a male and female fly.
A: The first visible difference between a male and female fly is their size. Generally, female flies…
Q: Describe the catecholamines. Give one example. Describe steroid hormones. Give one example. How are…
A: Step 1:Hormones are biochemical messengers by glands in the endocrine system that play a crucial…
Q: Please help answer
A: Structure 2. NucleusThe nucleus houses the cell's DNA, which contains the genetic instructions for…
Q: Outline the path of blood flow through the heart by listing the name (and associated number) of each…
A: Here is a detailed description of the role each structure plays in the path of blood flow through…
Q: Educake-Online Formative Ass X + e.co.uk my educake/quiz/144383766 Key Stage 3 Science - Biology…
A: Here's a detailed explanation of the liver, kidney, and bladder: A. LiverThe liver is a large, vital…
Q: For the behavior of a neuron when it is NOT being stimulated describe what is happens to the ions.…
A: Solution 1: Behavior of IonsIn a resting neuron:The inside of the neuron is negatively charged…
Q: Answer in step by step with explanation. Don't use Ai and chatgpt.
A: Approach to Solving the Question1. Understand the Context: Begin by recognizing that the question…
Q: How does ancestry and race play into disease genetics?
A: Disease genetics refers to the study of how genetic variations contribute to the development of…
Q: Tetrads are aligned at the center of the cell during which of phases?
A: In biology, a tetrad is a group or set of four. During meiosis, a tetrad refers to the four…
Q: Does this source pass the CRAPP test? How so? Farias PM, Marcelino G, Santana LF, de Almeida EB,…
A: Applying the CRAPP test—Currency, Relevance, Authority, Accuracy, and Purpose—to evaluate the…
Q: Which is true? All chordats are vertebrates, non chordates have a vertebral column, all vertebrates…
A: Before we can answer the question, we need to understand the terms involved. Chordates are a broad…
Q: In your own word write on cellular respiration more than one paragand Discuss differences with…
A: The conversion of the chemical energy that is stored in glucose into a form of energy that can be…
Q: Based on your results, which suspect's DNA best matches the DNA found at the crime scene?
A: The DNA evidence from the crime scene matches most closely with Suspect 3. The band patterns in the…
Q: Even if our brain had the capacity to interpret all the sensory information accurately and in…
A: In case you need further information, here's a thorough discussion: Even if our brain could…
Q: a) Write a simple driving question for the parts A, B and C of the figure. In other words, what…
A: For part A, the driving question could be: What is the effect of optix mosaic knockouts on the color…
Q: Biology Questions The questions are showed in the attached pictures.
A: Here are the terms that match each phrase: Step 1. Molecule containing genetic information a. DNA…
Q: Mean Height (SD) 4.5 3.5 3 2.5 2 points) 15 1 0.5 0 Control Phosphorus Mean Height (SD) 1 5 6…
A: This question is designed to test your understanding of limiting nutrients in ecology. Here's how to…
Q: A B ATP Identify the types of transport happening in the pictures above. Compare and contrast these…
A: Figure: Two types of cellular transport. In Figure A, facilitated diffusion is illustrated showing…
Q: Thoroughly explain how the splicesome works.
A: The spliceosome is a large and complex molecular machine found primarily within the nucleus of…
Step by step
Solved in 2 steps
- Osmosis is often defined as the flow of water through a semipermeable membrane, from a dilute solution to a more concentrated solution. Video experiment #1 – saturated sucrose/dialysis tubing/water osmosis from U Mich. https://youtu.be/pCupvFGN4bw A saturated solution of sucrose-containing a red dye is separated from water by dialysis material. What happens to the volume of sucrose solution during the experiment? How do you know that the sucrose solution did not flow into the beaker of water? (Give evidence from your observation of the experiment.) Diffusion, Osmosis, Dialysis video: https://youtu.be/tHzkRtzVmUMDialysis, the flow of both solvent and small molecules or ions through a dialyzing membrane, is important clinically in the operation of the artificial kidney machine.Five dialysis bags, impermeable to sucrose, were filled with various concentrations of sucrose and then placed in separate beakers containing an initial concentration of 0.6 M sucrose solution. At 10 minute intervals, the bags were weighed and the percent change in mass of each bag was graphed. Which line represents the bag that contained a solution isotonic to the 0.6 M solution at the beginning of the experiment? Which line represents the bag with the highest initial concentration of sucrose? Which line or lines represent bags that contain a solution that is still hypertonic at the end of 60 minutes? What is the best explanation for the shape of line e. after 50 minutes?What is happening in this trace? What do the peaks represent? Why is absorbance measured at 230 nm?
- After three minutes, the concentration of drug Zip in the red blood cells is 10 mmoles l-1. What is the average rate of entry of drug Zip into the red blood cells in units of moles min-1 red blood cell-1 during the first three minutes after placing the red blood cells into the bathing solution? Assume that each red blood cell occupies about 1 x 10-13 liters.From this standard curve and chart below, does the separation of molecules in the mixture appear successful from the gel filtration? Is there a clearlydefined separation between molecules? Explain your conclusions. Parameters required for calculation of coefficient (Kd) for unknown protein Volume eluted (mL) Which variable does this volume represent in the equation for Kd? Fraction with maximal DNP-Aspartate detected 36 Vt Fraction with maximal Protein detected 24 Ve Fraction with maximal Blue dextran detected 6 VoAfter blood collection, the red cells are separated from the serum to be used for the preparation of the stock solution. How is it done? For the serial dilution, your stock solution must have a concentration of 3.5 mg/mL. How much diluent must be added to the 5.3 mg/mL red cell to prepare the stock solution? Show pertinent solution/s. What is the appropriate diluent used for the preparation of the red cell suspension?
- Gel-filtration chromatography separates molecules according to their size . Smaller molecules diffuse faster in solution than larger ones, yet smaller molecules migrate more slowly through a gel- filtration column than larger ones. explain this paradox. What should happen at very rapid flow rates?As soon as lysis occurs, proteolysis, dephosphorylation and denaturation begin. These events can be slowed down considerably if samples are kept on ice or at 4°C at all times and appropriate inhibitors (protease and phosphatase) are added fresh to the lysis buffer. -Why inhibitors are necessary in this stage?-N-(2-hydroxyethyl)piperazine-N'-(2-ethanesulfonic A purified protein is in a Hepes acid) buffer at pH 7 with 375 mM NaCl. A dialysis membrane tube holds a 2.0 mL sample of the protein solution. The sample tube floats in a beaker containing 1.00 L of the same Hepes buffer, but with 0 mM NaCl, for dialysis. Small molecules and ions (such as Na+, Cl-, and Hepes) can to diffuse across the dialysis membrane, but the protein cannot. Assume there are no sample volume changes during the dialysis. Calculate the final concentration of NaCl in the protein sample once the dialysis has come to equilibrium. Calculate the final NaCl concentration in the 2.0 mL protein sample after dialysis in 150 mL of the same Hepes buffer, with 0 mM NaCl, twice in succession. [NaCl] after a single dialysis: [NaCl] after a double dialysis: mM mM
- A new 850 cm^2 membrane is being tested for use in a hemodialysis device. During testing, a model fluid mixture is used that contains solutes with average radii of 1 nm. In one test, the concentration of the filtrate is found to be 2.17 g/L, while the concentration on the feed-side surface is 8.52 g/L. Prior experimentation showed that the mass transfer coefficient in the device was approximately 9 × 10-4 cm/s. A) If the total filtration flow rate is measured to be 0.56 cm^3/s, what is the solute concentration in the feed solution? B) Explain how you could determine the average membrane pore radius for this membrane using this information.Infuse heparin at 1,200 units per hour from a solution containing 40,000 units of heparin in 500 mL D5W. How many mL/hr will deliver the ordered dosage?A mixture of proteins contains Pepsinogen (35 kDa), Fumarase (49 kDa), Transferrin (80 kDa) and Thyroglobulin (340 kDa). Rank these proteins based on the order of their elution from a gel filtration column (1 being the first one to elute and 4 as the last one). Throglobulin Pepsinogen Fumarase Transferrin