Which enzyme(s) should be used to clone this DNA and have it be transcribed from the CMV promoter? A. Xbal and Avril B. BamHl and EcoRl C. Xbal and EcoRl D. EcoRV and EcoRl E. EcoRV and Notl F. Other

Q: Which of the following enzymes is mainly responsible for recognizing the PAM sequence in the…

A: CRISPR (clustered regularly interspaced short palindromic repeats) sequences are found in bacterial…

Q: Retrotransposons are mediated by the enzyme O a. transposase O b. RISC O c retrotransposase O d.…

A: Retrotransposons move by a copy and paste mechanism. However transportions describe the copy is made…

Q: In 1997, Dolly the sheep was cloned using somatic cell by Kary Mullis. Lütfen birini seçin: O a.…

A: false

Q: ms in Column A with most related ones in B. Write the letters on the space provided.

A: Flavr Savr>inhibitor gene Bt eggplant/ Bt corn> Selective Toxicity

Q: During Western blotting, the primary antibody recognizesa. the secondary antibody.b. the protein of…

A: The western blotting is an identification technique which is used to detect specific proteins. It…

Q: Name a technique you would use to assess whether the gene Np1 is required for pain sensation? (Check…

A: To assess whether the gene Np1 is required for pain sensation, the following techniques can be used:

Q: Which method(s) of conjugation transfers chromosomal DNA to the recipient cell? A. F+ x F-…

A: The word conjugation means the transfer of the genetic material from one bacterium to another…

Q: the best technique to answer the following question: Does GAL4 transcription activator bind to GAL3…

A: We can detect GAL4 transcription activator binds to GAL3 co-repressor via Bacterial two-hybrid…

Q: Which of the following can be a achieved by CRISPR/Cas9-based genome editing tool? A. Knocking out…

A: CRISPR/Cas9 is a genome editing technology whose main function is to edit parts of genome by…

Q: Based on the restriction enzyme specificities given below, which will generate blunt ends?…

A: Restrictions enzyme or restrictions endonucleases is type of protein, produces bacteria that helps…

Q: In gene silencing, the “dicer” enzymea. assembles siRNAs into a RISC complex.b. unwinds the RISC…

A: Introduction: Gene silencing is a mechanism to regulate the expression of genes. The gene silencing…

Q: Choose the statement that best describes the outcome of transfecting cells with a plasmid that…

A: A plasmid is an extra chromosomal DNA present within a cell. It is physically separated from the…

Q: a. deleting that protein from an organism (knock-out).

A: Antisense can be defined as the strand of DNA that is not involved in coding. There are several…

Q: The original function of CRISPR-Cas9 in bacteria is to: a. eliminate the function of any gene in…

A: CRISPR-Cas9 It refers to a gene editing tool that depends on the natural defense mechanism present…

Q: D 5. Choose the letter that corresponds to the step in the process where a restriction enzyme is…

A: The letter that corresponds to the step in the process where a restriction enzyme is used - Step A.…

Q: We have isolated a mutant that changes transcription of many mRNAs, we can use          to determine…

A: Gene expression can be defined as the process that uses gene information for the synthesis of a…

Q: Match the terms with the type of transposon B. IS A. retrotranspson abundant in humans A L1 8 DNA…

A: A DNA (deoxyribonucleic acid)  that is capable of transposition, such segments are mostly found in…

Q: A mutation in one of the IR sequences of Tn5 would inhibit the transposition of the ISS0 sequence…

A: Introduction Tn5 is a transposon of composite nature that codes for transposase protein responsible…

Q: The DNA site of a person diagnosed with Sickle Cell Anemia will be:

A: Sickle cell anemia is a genetic disease which occurs due to substitution of glutamic acid by…

Q: A researcher would like to confirm whether the salmon purchased from the market is in LMO. Explain…

A: Organisms that have been genetically altered for increased yield, pest or disease resistance, or…

Q: Based on the restriction enzyme specificities given below, which will generate blunt ends?…

A: When a DNA fragment is subjected to the action of a restriction endonuclease enzymes, it cuts the…

Q: A collection of recombinant vectors that carry fragments of chromosomalDNA is calleda. a genomic…

A: Recombinant vectors are generally some live replicating virus particles which carry some extra genes…

Q: Which of the following statements about RT- qPCR is correct? 1. It measures the amount of CDNA in a…

A: RT-qPCR can be referred to as the combination of RT (reverse transcription) and qPCR (quantitative…

Q: In the phage titer experiment, why did you plate multiple dilutions?   a. so that you should have a…

A: Bacteriophage  It is a type of virus that infect bacteria.

Q: Which of the following is true?   a.     Enhancers are proteins that bind to activator DNA…

A: An enhancer is a brief piece of DNA (50–1500 bp) in genetics that can bind to proteins (activators)…

Q: When A. tumefaciens is used to make a transgenic plant, agene of interest is inserted into a…

A: Agrobacterium tumefaciens is a soil bacterium, which is used to transfer a small segment of…

Q: During the late stage T4 phage infection, the phage DNA is synthesized by Select one: O a. the DNA…

A: Bacteriophages are viruses that have bacterial as host cells.

Q: Which one is the best explanation for why substance "abuse or misuse" can be harder to recognize and…

A: Substance abuse refers to the harmful or excessive use of substances such as alcohol, prescription…

Q: In T4 phage, the initial transcription is carried out by_ Select one: O a. the DNA polymerase…

A: ANSWER;- d) the RNA polymerase encoded by the T4 phage genome. Explain;- T4 phage, the initial…

Q: Which of the following is NOT a true statement about CRISPR/Cas9? A. CRISPR/Cas9 is simpler to…

A: E. Delivery of CRISPR/Cas9 is not at all easy.

Q: Using CRISPR/Cas9 to target a gene in the mouse will primarily result in: a. Any of the choices b.…

A: CRISPR/Cas9 is a powerful tool that can be used to target and edit genes. This technology has a wide…

Q: The transcription initiation factor “recruited” together with RNA-Pol II in the formation of…

A: Transcription is a process of making an RNA copy from a gene’s DNA sequence. This is known as…

Q: The reason LacZ is frequently used as a reporter gene is: a. The lacZ gene product binds to the…

A: LacZ is a gene of lac operon which codes for β-galactosidase. The reporter genes cause a visible…

Q: You are trying to clone you favorite piece of DNA into the PUC vector shown above. You've pulled an…

A: Joachim Messing and colleagues developed a variety of plasmid cloning vectors, including pUC19. The…

Q: shown in the figure. Which of the following statements is true for the following experimental…

A: First, we need to know that what is the technique- q-rt-pcr? It stands for Quantitative Reverse…

Q: RNA microarrays can be used to determine which genes are turned on Select one: a. False b. True

A: The gene expression is the production of RNA from a particular DNA (gene) by the process of…

Q: 1. Which of these methods will allow cell counting and segregation? a. Flow Cytometry b. Western…

A: Introduction :- Bio-physical techniques or methods are combination of biological and physical…

Q: 96) The RT enzyme: a. The output is dsDNA. b. The enzyme works in the nucleus in case of the HIV…

A: Enzymes are mainly involved in recombinant DNA technology. Enzymes play a major role in the…

Q: What is the map distance between the two rapid lysis mutations re and rf given the data below? 2…

A: Hint: Always less numbered progeny becomes recombinants. In the question given that, re- rf- X r+…

Q: Identification and quantification of expressed genes initially requires a. reverse transcription of…

A: Gene is a basic unit of heredity and a sequence of nucleotides in DNA that encodes the Synthesis of…

Q: Translate the following mRNA transcript   5’CGCCGAUGCGCGAUAUGUGGUAA’3   A. RRCAICG   B. ADARYVV   C.…

A: mRNA, or messenger RNA is a type of RNA (ribonucleic acid) that plays a crucial role in the process…

Q: Introducing a specific change in the mouse genome using CRISPR/Cas9 requires: a. Alterations to both…

A: CRISPR based genome editing is widely applied in the field of biotechnology, medicine, genomic…

Q: Select the best technique to answer the following question: Where does the transcription factor…

A: The Nanog protein activator for the Rex-1 promoter by positive feedback mechanism and it's playing a…

Q: Attached is a cartoon model of the CRISPR system, with 3 critical components labeled.  A. What is…

A: CRISPR-Cas9 has recently become a popular set of tools for genetic engineering. By targeting…

Q: Deletion of these two genes resulted in the expression of multiple VSG's simultaneously.   a.

A: Trypanosomes Deletion of these two genes resulted in the expression of multiple VSG's…