When the reactions in part (B) are repeated in the presence of 12 ?M of an uncompetitive inhibitor, the y - intercept of the Lineweaver - Burk plot is 0.352 (?mol? 1mls). Calculate K? for this inhibitor. I tried 0.187 and it was off. Not sure what units to use either.

When the reactions in part (B) are repeated in the presence of 12 ?M of an uncompetitive inhibitor, the y - intercept of the Lineweaver - Burk plot is 0.352 (?mol? 1mls). Calculate K? for this inhibitor. I tried 0.187 and it was off. Not sure what units to use either.

Chemistry

10th Edition

ISBN:9781305957404

Author:Steven S. Zumdahl, Susan A. Zumdahl, Donald J. DeCoste

Publisher:Steven S. Zumdahl, Susan A. Zumdahl, Donald J. DeCoste

Chapter1: Chemical Foundations

Section: Chapter Questions

Problem 1RQ: Define and explain the differences between the following terms. a. law and theory b. theory and...

See similar textbooks

Related questions

Q: This cytochrome was shown to act as the electron donor to a selenate reductase (Se04²¯ + 2e¯ ⇒…

A: The objective of this question is to determine the final concentration of selenite in the reaction…

Q: Draw the structure of the major organic product of the reaction. NH₂ You do not have to consider…

A: The reaction between an ester and an amine is known as the "amide synthesis" or "ester amination"…

Q: (a) What is amino acid? Explain the function (or status) of an amino acid at pH 3 and 9. (b) What is…

A: a) Amino acid are organic compounds that contain amino ( -NH3+) and carboxylate ( - CO2-) along with…

Q: Kinetic assays were performed to better understand the activity of the enzyme 245C in the absense…

A: The kinetic data is given for enzyme-substrate reaction in the absence and presence of a molecule B.

Q: If a mixture was prepared by diluting 7.0 mL of the Blue#1 solution with water to a final volume of…

A: you have to use equation M1V1 = M2V2 15M(7)= M2 (12ml) and., M2 = 8.75 M b = 0.1044 k= - 0.0351

Q: Given the borax reaction: Na22B44O5(OH)4 × 8H2O(s) 2Na+(aq) + B4O5(OH)42-(aq) + 8H2O(l) What…

Q: 3. A student performed this experiment, and formed the solid AgoCr04. The solution above the…

A: The solubility of [CrO42-] = 6.67 × 10-5 M. The reaction is, Ag2CrO4⇌ 2 Ag++ CrO42-

Q: 1. An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show…

Q: 205.0 (6) 0 130.6 S(J/mol.K). 188.7 (6) O'H (6) H Gouersans (6) O'HZ - (6) O (6) "HZ +.

A: Hey, since there are multiple questions posted, we will answer first question. If you want any…

Q: The isoelectric point, pI, of the protein trypsin is 10.5, while that of horse liver alcohol…

A: The isoelectric point of amino acid is the pH at which the net electronic charge of the amino acid…

Q: The following is a Hill Plot for a receptor-ligand interaction: 8 6 (0-1) 601 4 2 0 -2 -4 -6 -6 4 -2…

A: Given:Hill plot for receptor-ligand interaction.Determine the fold difference.

Q: The bacterial load of a ketchup (pH-3.9) can be reduced from 6,000 units to 6 units in 15 minutes at…

A: A d-value is a term used in biology to find or calculate the total time it takes to reduce a…

Q: Let us that Za(OFI) () is completely notable, which signs that the precipitation mation with…

Q: An enzyme has a Km of 8 M in the absence of an inhibitor and an apparent Km of 12 M in the presence…

A: Given Km = 8 M (in absence of inhibitor) KmApp = 12 M (in presence of inhibitor) Inhibitor…

Q: dissociation constant, Kd, for a particular repressor-operator complex is approximately 10-¹1 M. The…

A: Dear student I am allowed to answer only 1 question so please post the other separately. I will…

Q: Draw the product of this reaction Ignore inorganic byproducts. Br2 (1 equiv) Q

Q: Which of the following is the primary and secondary species of EDTA at pH 2.05? (a) H&Y*, HsY* (d)…

A: EDTA is ethylene diammine tetraacetic acid. PH is defined as negative logarithm of hydrogen ions…

Q: Barring any incidental overlap, what are the total number of signals expected in the ¹H and 1³C NMR…

A: Since you have asked a question with multiple sub-parts, we will solve the first three sub-parts for…

Q: The following data were obtained for the hidrolysis of a sugar in aqueous solution at 230C 180 130…

A: Given, time /min [S] M 0 1.00 60 0.807 130 0.630 180 0.531

Q: Malic acid, (HO₂C)CH,CH(OH)(CO-H) has two acidic protons. What is the pk, for the following…

A: The pKa value is a measure of acidic strength of a solution. The higher the pKa value, the lower the…

Q: 1:4 (v) piperidine/DMF CF,CO2H Y CH2CI2 NH H2N. H2N. HN. NH NH2 NH3 NH2 + II II IV Consider the…

A: In the given reaction, the first step involved the treatment of base (piperidine is a base),…

Q: What is the AG" value for binding (not dissociation) for a compound binding a receptor 5x 10 M?…

A: Given Data:Kd (Dissociation constant) of a receptor = 5 x 10-7 MTo determine: value for a compound…

Q: A. Using the parameters for the binding affinity and cooperativity coefficient, calculate the…

A: The objective of this question is to explain the binding affinity and cooperativity coefficient play…

Q: Which of the following has highest priority based on CIP? A. -C=C B. -C(COOH) C-C(CH3)3 D.-C-NH3 E.…

A: CIP rule is based on the atomic number of the substituents. The priority is based on the first atom…

Q: An antibody X binds to an antigen Y. When the antigen concentration is 8.0× 10–8 M, θ is 0.90. What…

A: Given:Antigen concentration [B] = 8.0 × 10^(-8) MFraction of binding sites occupied (θ) = 0.90We…

Q: ular features that stabilize structure. 4. You perform Michaelis-Menten kinetics on (i) trypsin and…

A: a. Specific constant of the enzyme is the indicator of efficiency of the enzymes. The more is the…

Q: For the complex reaction with stoichiometry A + 3B →2R + S and with second-order rate expression -TA…

A: The speed at which the products are created from the reactants in a chemical reaction is referred to…

Q: For the reaction PCglu) • Clzlo) true based on the above? PCIsla) at a particular temperature, Ke -…

A: In chemical thermodynamics, the reaction quotient (QC) is defined as the measurement of the relative…

Q: 2. Complete the given table that the following three reactions occur in the direction as written: a.…

A: Given a. Zn(s) + Ni2+(aq) → Zn2+(aq) + Ni(s) b. Ni(s) + Pb2+(aq) → Ni2+(aq) + Pb(s)c.…

Q: II.2- Saponification of ethyl ethanoate, a second-order kinetic? Data: R = 8.314 J mol- K-1 The…

Q: calculate the values of the rate constant k-1, and the value of the dissociation constant of the…

A: [E] + [S] ←k-1→k1 [ES] → K2E +P K1 [E][S] = K-1[ES] K1 [E][S] = K-1[ES] + K2[ES] [reactant will be…

Q: loiV Inavi lo nolleo Attach: - Three data tables from Excel (one for each trial) showing the five…

A: The rate law for a chemical reaction is an expression obtained between the rate of the reaction and…

Q: Rate = -(Delta[RCl])/Delta t andln[RCl]t=-k*t+ln[RCl]0 < [R-Cl]-time equation Test tube A = 0.30…

A: “Since you have asked multiple question, we will solve the first two question for you. If you want…

Q: = 2. From the perspective of thermodynamics, the total free energy change of antibody (Ab) and…

A: “Since you have posted multiple questions, we will provide the solution only to the first question…

Q: In a Lineweaver-Burk plot of enzyme kinetic data, the x-intercept is –2.5 mM-1, what is the Km of…

A: Objective :Calculate Km

Q: please help this is my 4th time posting this and i havent gotten a correct answer. Please actually…

A: Please find the attached image.Details of axesX-axis: 1/S (reciprocal of the substrate…

Q: Construct the expression Kc for the following reaction. SCI,(g) + O,(9) = SO,CI,(g) 1 Drag the tiles…

A: Kc is the concentration equilibrium constant, that is the ratio of concentration of products and the…

Q: "[FeSCN2+]eq is calculated using the formula: [FeSCN2+]eq = Aeq/Astd x [FeSCN2+]std where Aeq…

A: First of all, FeSCN2+ can be obtained by the following interaction: Fe3+ + SCN- → FeSCN2+ The…

Q: 8. While studying the adsorption isotherm of acetic acid on charcoal, if 2.5 gm of charcoal be taken…

A: We use the Freundlich equation to plot Freundlich adsorption isotherm curve. Here adsorbate is…

Q: For a solution in which µ = 6.5 × 10-2, calculate K'sp for a. AgSCN (Ksp (AgSCN) 1.1 × 10-¹2, K'SP…

A: Solution Calculate Ksp solution

Q: 2. * Derive Michaelis-Menten equation under the assumption (Elo >> [SJo- 3. functions of the amino…

Q: 6. Five reaction mixtures containing equal concentrations of an enzyme are made up to the substrate…

A: The reactions that take place inside the human body are very complicated and slow reactions,…

Q: From the Hill Plot below, the KD of the first binding event for the receptor-ligand system under…

Q: For the reaction sequence shown below identify the products A and B. SMe2 • (AUCI(SMe,) Cu

A: N-heterocyclic carbenes are the inorganic compounds which is cyclic in nature. N-heterocyclic…

Q: In general, Please explan how to get > Condition No inhibitor max Thus, the y-intercept is equal to…

A: The Lineweaver-Burk equation is given as: 1V= KMVmax1S +1Vmax where V represents the reaction speed,…

Q: What is the value of the asymmetry term for 135Ba in the binding energy formula of the liquid drop…

Question

When the reactions in part (B) are repeated in the presence of 12 ?M of an uncompetitive inhibitor, the y - intercept of
the Lineweaver - Burk plot is 0.352 (?mol? 1mls). Calculate K? for this inhibitor. I tried 0.187 and it was off. Not sure
what units to use either.

AI-Generated Solution

AI-generated content may present inaccurate or offensive content that does not represent bartleby’s views.

Unlock instant AI solutions

Tap the button
to generate a solution

Click the button to generate
a solution

SEE SOLUTION

Similar questions

have a rate 13.124. Testing for a Banned Herbicide Sodium chlorate w in EU countries since 2009. A simple colorimetric test for the presence of the chlorate ion in a solution of herbicide was used relies on the following reaction: 2 MnO4 (ag) + 5 C103 (aq) + 6 H*(aq) → 2 Mn2+ (aq) + 5 C104¯(ag) + 3 H,0(0) The table contains rate data for this reaction. [CIO3 ]o (M) [H*]% (M) Initial Rate [MnO4 lo (M) (Mis) Experiment 5.2 X 10 0.10 0.10 0.10 1 3.3x 10 0.10 0.10 0.25 1.6 x 10 0.10 0.30 0.10 7.4 X 103 0.20 0.10 0.10 4 HO THE Determine the rate law and the rate constant for this reaction. 3,125 T 3.
Construct the expression for Ksp for solid Ba3(PO4)2 in aqueous solution. Вa (РО:)-(s) 3D З Ва" (аq) + 2 РО.* (аq) 1 Based on your knowledge of how the solid will dissociate in aqueous solution, use the tiles to form the expression. Ksp 5 RESET [Ba-(PO:)] 2[Ba:(PO:)-] 3[Ba:(PO:)-] [Ba-(PO:).J? [Ba:(PO:):]3 [Ba*] 3[Ba*] [Ba*j [Ba*"] 3[Ba"] [PO.2] 2[PO] [PO.P [PO.] 2[PO.] [PO. P 3[PO.] [PO. P
Write the products structures and mechanisms CO2H A = N. H (cat.) HO (a) ? NC. CN OMe solvent Ph (i) (ii)
The protein Westlin is 64% occupied when the concentration of its ligand, iocane, is 5 uM. Given this, the Kp of Westlin for iocane is uM. If the total concentration of Westlin is 2 nM, and the concentration of iocane is 10 uM, you know that the concentration of free protein must be nM.
e. urea 36. On a lineweaver-Burk plot of kinetic data for an enzyme in the presence 1 x 10 M of a classic noncompetitive inhibitor, the y-intercept = 4 x 10M min and the x-intercept = -5 x 10' M'. What is the true Km of the enzyme? a. 2.0 x 10 M M b. 2.5 x 10 c. 1.2 x 10 M d. 0.8 x 10 M. e. 1.2 x 107 M
2. Using molecular simulations it is possible to compute the free energy change AG for the nonphysical reaction CH3-CH2-CH3 CH3-CH3 (Propane Ethane) in any desired solvent. Simulation data give the following results AG°(vacuum)=0.5 kcal/mol AG (octanol)=2.0 kcal/mol AG (water) 1.0 kcal/mol (a) The experimentally measured free energy of transfer AGx(propane) of propane from octanol to water is 4 kcal/mol and from vacuum (gas phase) to water is -0.2 kcal/mol. Calculate the corresponding values of AGOx(ethane) from octanol to water and from vacuum to water. b) Assume that the free energy of transfer of a methylene group from water to octanol is a measure of the strength of the hydrophobic driving force for burial of such a group during protein folding. Calculate the expected approximate decrease in stability (as a result of reduced hydrophobicity) for a Leu Ala substitution at a buried site in a monomeric globular protein. The measured decrease in stability is twice the theoretical…
1- Write the Nernst equation2 for the reaction Cu2+ (aq) + Zn (s) ® Zn2+ (aq) + Cu (s) Let activity of Cu2+ equal to 1 and change the activity of Zn2+ such that Q is in the range - 0.001 to +0.001. Select different values of Q and for each calculate Ecell. 2- Plot Ecell-Ecelle vs In Q. What is the effect of Q (that is the activity) on Ecell-Ecelle ? Is the effect the same at higher and lower values of Q? 3- what is the largest value of the absolute difference between cell potential and standard cell potential. Ecell-Ecelle? What do you expect the graph will look like for different number of electron transferred (n )? And why?
Part 3: Effect of Temperature Table 3 Temperature C Time in seconds Rate [I2]/time Value of k 46.5 26sec (Using the values of the exponents x, y and z determined in Part 1, the above rate and the concentrations of the reactants for mixture I, determine the value of k at the temperature of the water bath.).Show calculation: 6 What effect did the increase in temperature have on the value of k? 7) Using the Arrhenius equation, determine the Ea in kJ/mol for the iodination of Acetone. In (k/ki) = (Ea÷R)(1/T1 – 1/T2) R = 8.314J/mol.K %3D Ea MU
Would the exponents, m and n, in your rate expression be larger than, smaller than, or unchanged from the correct values as a result of each of the following mistakes? Indicate clearly your reasoning. Experiment 3: 20.0mL of 0.10M KI, 5.0mL of distilled water, 5.0mL H2O2 rate = k[H2O2]m[I-]n a) A leak occurred around stopper A in the mouth of the Erlenmeyer flask during experiment 3.
you use a 30 m long column with an internal diameter of 0.25 mm and a film thickness of 0.25 μm. (a) Estimate the value of H for this column. b) On this column, a pair of compounds that you wish to separate has an alpha. value α of 1.01 and the k value of the second component k2 is 5. Will this columns provide a resolution of greater or less than 1 or this pair of compounds.? Explain
5. The following kinetic data are recorded for equal amounts of the enzyme, proline racemase, in the absence and presence of an inhibitor, I. Based on the Lineweaver-Burk plots: a. What type of inhibitor is I? b. Calculate the Km and Vmax in the presence and absence of the inhibitor? c. Calculate Ki of the inhibitor when 0.4mM inhibitor is used. 0.5 0.4 0.3 0.2 0.1 -0.2 -0.1 0.1 0.2 0.3 0.4 -0.1 1/[S] (1/mM) 1/V (min/mM)
Aspirin can be synthesized from salicylic acid and acetic anhydride in the presence of catalytic H,SO, catalytie H90, d183 gimi. (0.05 mol) according to the reaction saieylie acid CHO MW-13812 amal acetyi chleride CHO. M 100 0 d d1.08 gim anpirie CO, MW 180.1s gmel shown. If 1.0 mol of salicylic acid and 3.0 A) H,SO, mol of acetic anhydride react, which B) salicylic acid is considered the limiting reactant? C) acetic anhydride