What issue divided Vietnam? O A border dispute with China O Whether Communism or Democracy would govern the nation Soviet invasion O A disagreement on whether to join the United Nations Where was the border between North & South Vietnam located? 38th Parallel 20th Parallel O 10th Parallel 17th Parallel
Q: Arrange the best steps to take to identify the gene and mutation that causes the lung cancer. Not…
A: The quest to uncover the genetic basis of lung cancer presents a complex challenge, requiring an…
Q: From the choices below, which are reputable sites that can be used to locate scientific journal…
A: Science is a term which is used for the study of the subject which is based on the facts and…
Q: A biologist gathered data to show the interaction of the golden-cheeked warbler and juniper tree…
A: It is given that the bar colored in light grey gives the number of juniper tree person acre and the…
Q: 6. Summarize: How are respiration and photosynthesis related to each other? Use the balanced formula…
A: Photosynthesis is an anabolic process in which green plants prepare their own food by utilizing…
Q: For the climatographs shown below, which of the following statements is/are true? Select all that…
A: A Climatographs or climographsare well used to defined the graphical illustration of a locality…
Q: Please help urgently with this question please?
A: Actin is a globular protein that forms microfilaments, a type of cytoskeleton present inside most of…
Q: Which level(s) of protein structure can you find the a helix and the B pleated sheet? CHECK ALL THAT…
A: Introduction:- A protein molecule is much larger than a sugar or salt molecule, and it is made up of…
Q: The diagram below shows a setup for a plant investigation. Which variable is most likely being…
A: Experimental design can be defined as a research methodology in which one or more characteristics…
Q: Which is NOT a modification made to pre-mRNA? addition of a 5' cap removal of introns addition of a…
A: In bacteria, RNA transcripts are ready to act as messenger RNAs and get translated into proteins…
Q: I need question 42
A: Homologous recombination [hr] is the exchange of DNA sequence between DNA molecules that have very…
Q: Global Warming Experiment Iker is concerned about global warming. He believes that much of the…
A: Global warming is the unusually rapid increase in Earth's average surface temperature over the…
Q: • The diagram below shows a sequence of DNA (a nucleic acid) that codes for an extremely short…
A: DNA is the hereditary material. It is present in almost all organisms.
Q: Use the following information to answer the question: Many species of food crops have been…
A: Organisms and their environments are inextricably linked and interdependent. Every alteration in the…
Q: SigmaS is the stationary phase sigma factor. Which of the following is a likely site for RNAP-Sigmas…
A: Sigma factor- A sigma factor is a protein needed for initiation of transcription in bacteria . it…
Q: I need help with question 2 it’s urgent
A: Initial Observation: - The person (Spongebob) is suffering from an illness and is suggested by two…
Q: L L 01:20:06 When a person is sick with a bacterial infection, doctors often prescribe antibiotics…
A: Bacteria or other pathogens develop resistance to the drugs. This helps them to survive despite much…
Q: Refer to the accompanying figure. In which part of the muscle fiber are calcium ions stored?
A: Muscle tissue contains something called muscle fibers. Muscle fibers consist of a single muscle…
Q: All of the following are epigenetic mechanisms that can influence a gene's function EXCEPT? O…
A: The epigenetic control of DNA occurs when the changes in the phenotype occur without a change in the…
Q: Answer this question asap quickly fast thanks
A: Endocrine hormones are released by the endocrine glands directly into the bloodstream. Thus,…
Q: 1. Cross a person with heterozygous type B blood with a person with type AB blood. List the…
A: 1. Blood is a circulating biological fluid in the body composed of blood cells and plasma.…
Q: Which procedure should have been performed to prevent error in this investigation?
A: The correct answer is d, Both groups should have been tested in the same soil type at each humidity…
Q: 4. A researcher suggests that small doses of hyaluronic acid (HA) will promote the uptake of water…
A: A hypothesis is an assumption that is made based on some evidence.
Q: match corresponding grid row below. 1. a nurse with an associate's degree in nursing or a bachelor's…
A: Health care is described as the effort made by qualified and licensed healthcare professionals such…
Q: 4)In 2018, the atmospheric concentration of CO2 was 408 pm, and the concentration of methane was…
A: Parts per billion (ppb) is a unit of measurement used to express the concentration of a substance in…
Q: nswer any three.
A: As we know Hemoglobin is a product made from heme+globin. The presence of heme gives the red color…
Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O…
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction:…
Q: | 11. Fill in the correct answers below. e. A specific example of a carbohydrate monomer is: ANSWER…
A: Macromolecules are large, substances made up of repeating components such as carbohydrates, lipids,…
Q: Please help me with this question within an hour immediately needed
A: EL-nino event occur when the surface water of pacific becomes warmer and the east wind blow weaker…
Q: 5. Active transport allows cells to maintain higher concentrations of many different molecules than…
A: Membrane transport of polar or charged species requires additional help from channels or transporter…
Q: PRACTICE PROBLEMS OSAL 1. Using the proportional or formula method, calculate the following adult…
A: It is always important to administer the right dose to the patient to ensure effectiveness of a drug…
Q: Multiple answers questions. SELECT ALL THAT APPLY. Which of the following are ORGANIC components of…
A: As we know Bone is the living tissue that makes the skeleton of the human body. Bones provide and…
Q: Please help me with this question within an hour immediately with complete answer
A: Please Post Questions Separately.
Q: Figure 2.25 Ocean acidification. CÓ, HO H₂CO H₂CO₂H+ HCO3 HACO HCOS CO₂ + Ca CaCO₂ Scientific Skills…
A: This question is about interpreting a scatter plot with a regression line from an experiment that…
Q: 15. LO1.3 The respiratory systems primary function is to: a. Fight infection. b. Warm the air. c.…
A: Physiology is the study of normal functions within the living. It involves the study of various…
Q: The biological purpose of the crop is to: grind food to compensate for lack of teeth balance the…
A: The biological purpose of the crop is to Grind the food to compensate for the lack of teeth…
Q: Starting appear in squalene. 14 H3C COA 5.) Starting with the following radiolabeled acetyl-CoA map…
A: Introduction: Biosynthesis of cholesterol occurs from the acetyl-CoA in four stages.
Q: 1. Gene expression can be regulated at the level of a) transcription b) RNA stability c) translation…
A: Note - Since you have asked multiple questions, we will solve the first question for you. If you…
Q: Anaerobic Respiration O ceus uhen orgen is aBsent. Anaerobic respiration can occur in the presence…
A: 2 types of fermentation are (a)alcoholic fermentation and (b)lactic acid fermentation. Lactic…
Q: Please help me this question ASAP need to submit urgently
A: Answer is option b.) double stranded , circular DNA molecule.
Q: I need Question 39
A: Nucleotide excision repair is a type of mechanism of DNA repair which is particularly involved in…
Q: Which part of the brain helps prioritize sensory information?
A: As we know brain is a network of billions of neurons which carry information and transport them in…
Q: An uncatalyzed reaction has a rate of 4.2 x 10-7 sec-1. When an enzyme is added the rate is 3.2 x…
A: Enzymes are proteins present inside organisms, which function to work as biological catalysts. These…
Q: I need question 41
A: Central dogma of life involves the way in which proteins are synthesized from double stranded DNA.…
Q: A transmembrane protein that can change conformation in response to an lonic charge/current and…
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: You are studying the regulation of a bacterial gene (TolU) that encodes an enzyme that is necessary…
A: First, let's start with a definition. Promoter: It is the sequence of DNA that is required to turn…
Q: 2. In the exotic leafhopper, Buggus imaginarius, 3 X-linked genes have been identified: the…
A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: People are very interested in understanding how prions fold. (Prions are proteins that begin…
A: 1. To determine which protein, mouse or bovine, will be more "folded" at 310K, we need to compare…
Q: One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base…
A: The given strand represents the complimentary strand of DNA. The complimentary strand. Given the…
Q: When the gene encoding a certain cellular kinase is deleted, the resulting mutant cells arrest in…
A: Answers : fusion protein are the proteins which are synthesized in the laboratory for the…
Step by step
Solved in 2 steps
