Q: The following sequence of nucleotides is found in a single-stranded DNA…
A: DNA is the double-stranded molecule that is the genetic material in most animals except for some…
Q: 5’-GTCGTATAGTGA-3’ 3’-CAGCATATCACT-5’ What does the newly formed RNA sequence look like if the RNA…
A: DNA forms a double-helix in which two antiparallel strands are wound around each other. The two…
Q: What is the complementary hnRNA base sequence produced from the DNA base sequence 5' C-T-A-T-A-C 3'?…
A: As per our guidelines we are supposed to answer only 3 sub parts.
Q: How many tRNA molecules can associate with a ribosome at any given time during translation
A: The translation is the process of the formation of polypeptide chains of amino acids that lead to…
Q: 18S rRNA is transcribed by Question 29 options: RNA polymerase I RNA polymerase…
A: As we know that RNA polymerase is responsible for transcribed all different type of RNA in…
Q: What is the DNA template for the RNA sequence 5' UAACGGAGCCUAAUC 3'? O 5' GAUUAGGCUCCGUUA 3' O 5'…
A: In reverse transcription, RNA is "reverse transcribed" into DNA. This process, catalyzed by reverse…
Q: Below is a double-stranded DNA: ATATGTGGTCTCGGTCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA 1. In…
A: The first step in gene expression is the synthesis of an RNA molecule copied from the segment of DNA…
Q: The fact that some eukaryotic rRNAs are self-splicing indicates that RNA structures are highly…
A: Introns are non-coding sequences, which are removed during the process of splicing. Splicing is…
Q: Intrinsic RNA chain termination is determined by specific sequences in the DNA called ____ sites.…
A: Termination during transcription occur via 2 methods. Intrinsic termination:- promote termination by…
Q: One of the following best describes the cap modification of eukaryotic mRNAa) Modified guanine…
A: DNA is the genetic material that carries genetic material in the form of coded nucleotide sequences.…
Q: The coding sequence for gene F is read from left to right on the accompanying figure. The coding…
A: DNA is the polymer of nucleotides.
Q: Which type of chemical bond is responsible for RNA-DNA base pairing during reverse transcription?…
A: The DNA and RNA nucleic acids that is composed of nucleotides. The nucleoitides are made up of…
Q: How do I translate the DNA sequence below: 5'-ATGGCCTGGCATTCA-3' 3'-TACCGGACCGTAAGT-5'
A: DNA stands for Deoxyribonucleic acid. It is a molecule composed of two polynucleotide chains to form…
Q: The DNA sequence below is used by the primase to synthesize a primer. What is the sequence of the…
A: The primer of this sequence will be complementary to it. The complementary bases are as follows: A…
Q: 1. (a) What will be the newly synthesized DNA from the template given? DNA Template 3 -…
A: The base-pairing rule in DNA is that cytosine (C) pairs with guanine(G) and adenine (A) pairs with…
Q: Left Right The orientation of the template strand represented 5' to 3' for the above transcription…
A: You can see size of the branches increase from right to left that means the transcription occurs…
Q: What is a reasonable length for an RNA primer in E.coli? A. 1000 nucleotides B. 100…
A: In DNA replication one strand of DNA which is lagging require RNA primer to start the synthesis of…
Q: What is RNA editing? Explain the role of guide RNAs in RNA editing.
A: A molecular process in which some cell makes a discontinuous change to nucleotide sequences in their…
Q: A tRNA in E. coli charged with His (histidine) would have the anticodon:
A: Translation -- the process of formation of proteins from the RNA tRNA are the type of RNA which…
Q: sing the genetic code provided what would be the corresponding polypeptide sequence for the DNA…
A: The DNA is transcribed into the RNA by the process of transcription and the RNA is translated into…
Q: DNA: 5’-CTCTACTATAAACTCAATAGGTCC-3’ -Write the sequence of the RNA molecule that will be…
A: The transcription is the process in which the mRNA copied information from DNA for protein…
Q: Which statement is true about RNA polymerase (which is required for transcription)? A. RNA…
A: Transcription It is the process through which the sequences in strand of DNA forms into the…
Q: How do I determine the eventual amino acid code from: 3' TACCCCGGGTTTCAACATG 5' -(TEMPLATE STRAND)…
A: In double stranded DNA , one strand is known as template strand and other one is the coding strand.…
Q: The following eukaryotic DNA sequence is a made up gene. It is a mutated variant from the one that…
A: The genetic framework is a collection of instructions used by living cells to decipher data encoded…
Q: It was discovered that COVID19 RNA is a sense (+) strand. If the RNA sequence that codes for the 5…
A: A sense strand, also known as a coding strand, is a stretch of double-stranded DNA that carries the…
Q: Fill in the complementary DNA strands for the DNA strands below Which nitrogen base CAN'T you use…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: I. List the sequences of RNA that would be transcribed from the following DNA template sequences. а.…
A: Transcription is the initial stage in gene expression, when genetic information is utilised to build…
Q: Shown below is a hypothetical RNA molecule. Which of the following corresponds to the template DNA…
A: RNA is produced from the DNA template by the process known as transcription that occurs within the…
Q: Given the double-stranded DNA molecule shown below, what is the sequence of the MRNA corresponding…
A: Given information: Coding strand 5' TATGAAATTTAAATTT 3' Template strand 5' ATACTTTAAATTTAAA 3'
Q: The following sequence of nucleotides is found in a single-stranded DNA template:…
A: The process of formation of mRNA from DNA is called transcription.
Q: how do you translate this sequence RNA A C U G U C A U G A G C C C U G C A…
A: Translation is the process by which proteins are synthesized by the ribosomes after the process of…
Q: Which type of RNA serves as the genetic template (blueprint) utilized by the ribosome during the…
A: Rna is ribonucleic acids which are formed by ribonucleotides .
Q: Original ONA Strand A-C-C-G T-A-C T-G-G-AA-T-G Complementary DNA Strand What is the most likely…
A: DNA Replication is the synthesis of new daughter DNA strands complementary to the template DNA…
Q: The template strand of a gene contains the following sequence: 3'-TAC TTG TCC GAT ATC-5' Following a…
A: Introduction A mutation is a change in the sequence of nucleotides in DNA or RNA. Everyone is…
Q: A codon is a triplet of bases which codes for an amino acid. Exons are intervening sequence that are…
A: These are true or false statements. Explanations are given as well.
Q: If the following piece of DNA were used as a template for transcription, what would the sequence of…
A: Transcription the process in which RNA is formed out of the DNA the processing that is translation.…
Q: From the following DNA template, which sequence is synthesized by RNA Polymerase? 5’- T – C – C…
A: According to the central dogma of molecular biology, the information stored in DNA is first…
Q: Frameshift mutation _____________________ Select one: can result in a completely new codon sequence…
A: These mutations include insertions or deletions in between the nucleotide sequence of the genome,…
Q: Draw a Concept Map of the Central Dogma in order to summarize and connect the concepts. Write…
A: Central Dogma is a flow of information that is present in the form of nucleotide sequence on the DNA…
Q: What is a Shine-Dalgarno sequence? The template sequence found in the RNA part of telomerase A…
A: The correct answer is that the Shine- Dalgarno sequence is a sequence that base- pairs with 3' end…
Q: The following is a sample primary RNA transcript. What must first occur before it can be translated?…
A: Introduction Transcription Is The Process Of Copying Information From A Strand Of DNA Into A New…
Q: Draw a DNA helix opened up to copy a single gene (CAREFUL this is NOT a replication bubble). You can…
A: Transcription is the first of several steps of DNA based gene expression in which a particular…
Q: Both strands are shown; the top strand reads 5' to 3' left to right, while the bottom strand reads…
A: The central dogma in both prokaryotic and eukaryotic cell consists of a series of steps including…
Q: Draw an arrow underneath the DNA representing the RNA being made (be sure it starts in the right…
A: DNA or deoxuribonucleic acid is a polymer of deoxy ribonucleotides connected together via…
Q: Hetero Nuclear RNA or hnRNA is the unmodified transcript. What process cuts out pieces of this RNA…
A: Gene expression is the phenomenon by which information in the DNA is translated to produce a…
Q: With regard to RNA polymerase proofreading ability, which of the following is true? OA 3'5'…
A: Answer : with regard to rna polymerase proof reading, the true statement is : no proofreading…
Q: You are working in the lab and are mutagenizing E. coli, to see if you can identify mutations in the…
A: Gene expression is a process by which the genes are turned on to form RNA and proteins. This is…
Q: A biochemist was able to sequence a DNA found in a human sample from humans who were first believed…
A: The DNA is a self-replicating structure formed of two strands. The DNA is formed of nucleotides. The…
Q: Which RNA polymerase makes tRNA? RNA pol I RNA pol II RNA pol III RNA pol IV
A: The production of RNA from the DNA template is known as the transcription process that occurs within…
Q: The following is a part of the sequence on DNA template strand. 5' ATGGCCCGGTAAGTA 3' Write the…
A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA that codes for a specific…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- 5'-AGA-ACT-AAA-CTA-TCG-CTT-CGT--3' mRNA: original protein: mutated mRNA: mutated protein:A protein uses a gene template in 3' to 5' direction. What are the amino acid sequences following this DNA chain? 5'-ATGTCGACAGCCTAA-3' First Second Letter Third Letter U A G Letter phenylalanine serine tyrosine cysteine U phenylalanine serine tyrosine cysteine U leucine serine stop stop A tryptophan arginine arginine leucine serine stop leucine proline histidine U leucine proline histidine leucine proline glutamine arginine A leucine proline glutamine arginine G isoleucine threonine asparagine serine U isoleucine threonine asparagine serine A isoleucine threonine lysine arginine A methionine threonine lysine arginine G valine alanine aspartate glycine U valine alanine aspartate glycine G valine alanine glutamate glycine A valine alanine glutamate glycine G O Met-lle-Thr-Ala-STOP O Met-Ser-Thr-Ala-STOP Met-Ser-Trp-Arg-STOP Met-Tyr-Thr-Arg-STOPWhat is the RNA transcript that would result from the double stranded DNA segment shown below? 5'-GCACGTTGGTCGATCACGTAATATACGCATCGACTCCCGATCGA-3' 3'-CGTGCAACCAGCTAGTGCATTATATGCGTAGCTGAGGGCTAGCT-5' 5'- ين
- DNA ATG AGG 11 13 --UCA- MRNA 12 14 TRNA 10 Ser 15What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC-5 O 3- GCCTACGGGCATATG -5 O 5-GCCTACGGGCATAAG -3 O 5- GCCTACGGGCATATG-3 O3-CGGATGCCCGTATAC -5Assume that you are a RNA polymerase. Which strand is the template strand? -5 ↓ 3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’
- Provide the complementary strand and the RNA transcription product for the following DNA template segment:5'-AGGGGCCGTTATCGTT-3'A protein uses a gene template in 3' to 5' direction. What are the amino acid sequences following this DNA chain? 5'-ATGTCGACAGCCTAA-3' First Second Letter Third Letter Letter phenylalanine phenylalanine serine tyrosine tyrosine cysteine cysteine U serine leucine serine stop stop A leucine serine stop tryptophan arginine G leucine proline histidine leucine proline histidine arginine leucine proline glutamine arginine arginine A leucine proline glutamine isoleucine threonine asparagine asparagine lysine serine isoleucine threonine serine A isoleucine threonine arginine methionine threonine lysine aspartate arginine valine alanine glycine glycine valine alanine aspartate C G valine alanine glutamate glycine glycine A valine alanine glutamate O Met-lle-Thr-Ala-STOP O Met-Ser-Trp-Arg-STOP O Met-Tyr-Thr-Arg-STOP O Met-Ser-Thr-Ala-STOPWhat is the base sequence of the MRNA synthesized from the following DNA template strand? 3'-A-C-A-T-C-G-5'