Use the pre-mRNA sequence shown below to answer the following questions. MRNA: 5'ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3' a. Underline the 5' and 3' splice sites, then write the sequence of the spliced mRNA in the space provided. b. Predict what would happen if the G in the 5' splice site were mutated to a C . c. We learned in this topic that the 5' cap in an mRNA plays a role in translation initiation. What do you think is one plausible mechanism by which a 5' cap can enhance initiation ? How can you experimentally demonstrate that a 5' cap is important for this process ?

Use the pre-mRNA sequence shown below to answer the following questions. MRNA: 5'ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3' a. Underline the 5' and 3' splice sites, then write the sequence of the spliced mRNA in the space provided. b. Predict what would happen if the G in the 5' splice site were mutated to a C . c. We learned in this topic that the 5' cap in an mRNA plays a role in translation initiation. What do you think is one plausible mechanism by which a 5' cap can enhance initiation ? How can you experimentally demonstrate that a 5' cap is important for this process ?

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

The initiation factors a. help assembling both ribosomal subunits with mRNA and initiator tRNA b. help with the peptide bond formation c. help starting the translation elongation d. are responsible for the initiation of ribosome translocation
The addition of the poly-A tail adds more than 200 units of adenine to the strand of mRNA, yet no protein has a continuous line of more than 200 phenylalanines in its structure. Why is this so? A. RNA splicing occurs and removes the noncoding sequences. B. The poly-A tail and 5' GTP cap do not translate into proteins. C. The adenines are reabsorbed by the cell and help to form other forms of RNA. D. The tRNA does not recognize the poly-A tail.
Considering only the listed genetic elements in the figure below, how many different mRNAs and polypeptides can be made from this DNA fragment? Promoter start Codon Transcription terminator STOP Start STOP codon Lodon codon O A. 1 mRNA and 3 polypeptides B. 3 mRNA and 3 polypeptides C. 1 mRNA and 2 polypeptides D. 2 mRNA and 3 polypeptides Promoter Start codon Transcription terminator STOP codon
Define (whether post-transcriptional, post-translational, transcription) and describe the regulation of the Ferretin mRNA in the diagram below.
What happens when one base pair of DNA is lost from the coding region of a gene because of mutation? First explain how this would affect the mRNA sequence, and second, explain how this would alter the amino acid of the protein that is encoded.
Please type clear answer
Which is the correct option here? How can one primary transcript result in several polypeptides with different amino acid sequences. A. Phosphorylation of proteins after translation B. alternative splicing of exons C. An addition of polyA tail to mRNA D. Incorporation of an amino acid at a stop codon
During RNA splicing a. All exons are removed and degraded in the cell b. mRNA is made from DNA template c. Introns are removed from the mRNA and the exons are spliced together d. mRNA is translated into a protein molecule
Alternative splicing allows for more proteins to be made from the same region of DNA; explain how you can get multiple proteins from the same DNA. Then explain if alternative splicing changes the DNA and/or the mRNA. Draw or diagram out an image to depict this.
what is the first event to take place in translation in eukaryotic cell? a. An clongation of the polypeptide chain by the addition of amino acids b. Binding of the larger ribosomal subunits to the smaller ribosomal subunits c. Base pairing of activated methionine-tRNA to AUG of messenger RNA d. The small subunits of ribosome recognizing and attaching to 5' cap of mRNA
To start transcription, RNA polymerase binds to a please explain your answer a.initiator complex b.promoter sequence c.trigger factor d.Rho factor e.Shine-Dalgarno sequence
Eukaryotic MRNAS contain a poly(A) tail at the 3'-end, but the template DNA encoding the mRNA does not have poly(T)s. Identify the statements as true or false. A. The enzyme that makes polyA tail is a template-independent polymerase B. The polyA tail is added at the 3` end of MRNA C. The polyA tail is added at the 5 end of MRNA D. The polyA tail is added by DNA dependent RNA polymerase E. PolyA tail plays an essential role in transcription