Use the following information to answer the next few questions. Your father has been advised that when he eats anything with dairy in it, he also should be taking pills that contain the enzyme 'lactase'. People that can easily eat dairy naturally produce lactase in their small intestines. The enzyme hydrolyzes lactose (a sugar), into galactose and glucose. Some people do not produce enough lactase. In them, the lactose continues past their small intestine and into their colon where bacteria break it down and cause 'gastrointestinal symptoms'. Prolonged exposure to lactose can encourage these bacteria to grow. In the enzymatic reaction described above: Lactose is a(n) Galcatose and glucose are each considered a(n) Lactase is the substrate end product enzyme

Use the following information to answer the next few questions. Your father has been advised that when he eats anything with dairy in it, he also should be taking pills that contain the enzyme 'lactase'. People that can easily eat dairy naturally produce lactase in their small intestines. The enzyme hydrolyzes lactose (a sugar), into galactose and glucose. Some people do not produce enough lactase. In them, the lactose continues past their small intestine and into their colon where bacteria break it down and cause 'gastrointestinal symptoms'. Prolonged exposure to lactose can encourage these bacteria to grow. In the enzymatic reaction described above: Lactose is a(n) Galcatose and glucose are each considered a(n) Lactase is the substrate end product enzyme

Nutrition Now

8th Edition

ISBN:9781337415408

Author:Brown

Publisher:Brown

Chapter28: Nutrition And Physical Performance

Section: Chapter Questions

Problem 13RQ

See similar textbooks

Similar questions

Lactose intolerance is caused by reduced production of the enzyme lactase. A variety of digestive system problems, such as celiac disease and Crohn’s disease) can also lower the production of lactase. If an individual produces low levels of the enzyme lactase, explain why they might be able to tolerate eating dairy products that contain lower levels of lactose (e.g., hard cheeses, feta cheese, and cottage cheese), but will not be able to tolerate foods with high levels of lactose (e.g., milk).
Create a diagram showing the process of how to make Salivary Amylase. the diagram can be generic to the making of any protein, starting with the DNA in the nucleus and ending with the exocytosis of the Salivary Amylase out of the cells in your salivary glands NOT GRADED
Please make a diagram showing the process of how to make amylase. The diagram can be to the making of any protein, starting with the dna in the nucleus and ending with the exocytosis of the salivary amylase out of the cells in the salivary glands. Please show work and pictures. Thank you.
Whenever a person consumes dairy products, they utilize lactase enzymes to break down the disaccharide carbohydrate, lactose into monosaccharides: galactose and glucose. Overtime, these enzymes become worn and need to be replaced. The following DNA sequence contains the information needed to build more lactase enzymes: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ 5’ – TGGAGAATGAAAATATATATCCCTTCTGATTAACAG– 3’ Which strand is the template strand?
People with lactose intolerance cannot digest the common dairy sugar lactose. Besides being careful not to eat dairy foods, is there anything else a lactose-intolerant person can do?
Do you agree or disagree with the following statements? Explain your answer. Neutralizing the negative charge on the carbohydrate portions of a proteoglycan should cause the ECM that houses the proteoglycan to become more liquefied.
Would substituting fiber and complex carbohydrates (larger % cellulose) for the simple sugars and starches (high sucrose and amylose/amylopectin) help Morgan lose weight, why? Yes, because complex carbohydrates like cellulose are largely indigestible so they pass through the digestive tract without being absorbed. Yes, cellulose contains less glucose residues than amylose or amylopectin. Yes, because the fructose in sucrose is much more responsible for weight gain than the glucose. No, because cellulose, amylose, and amylopectin are all composed of glucose so it doesn’t matter.
You have the task of producing 3 kilogram of porcine (pig) insulin from pig pancreases to create an emergency stockpile of insulin. You know that a typical adult pig has a 269 gram pancreas and it is possible to produce 15 micromoles of purified insulin from 1 kg of pancreatic tissue. How many fresh pig carcasses would you need to produce 3 kg of insulin?
True or false Lactase breaks down all the disaccharides
Sarah is trying to build muscle, so she wants a high-protein drink, but she is also lactose-intolerant. Which of the following milk products provides the same amount of protein as whole milk, but is also free of lactose? Choose all that apply. 2% Cow's Milk Nonfat Cow's Milk Soy Milk Almond Milk Coconut Milk Lactaid
based on where they perform their functions the enzymes amylase and maltase in human saliva are classifies as________.
Which carbons of glucose will be incorporated into Palmitic acid by the Fatty Acid Synthase? Multiple answers:Multiple answers are accepted for this question Select one or more answers and submit. For keyboard navigation...SHOW MORE a Carbon 1 b Carbon 2 c Carbon 3 d Carbon 4 e Carbon 5 f Carbon 6 g All carbons will be incorporated. h No carbons will be incorporated.