The genetic code is said to be degenerate, which means that: A An anticodon can interact with more than one codon in the mRNA in which the codon may differ in any or all of the three nucleotides. (B) Each codon codes for more than one amino acid. (C) The code is universally used by virtually all species. (D) Most amino acids are coded for by more than one codon.

Q: 10 μm

A: Euglena belong to phylum euglenophyta. they are unicellular photosynthetic freshwater potest that…

Q: What is a benefit of uniform dispersion?         decreased competition…

A: Uniform dispersion, also known as uniform distribution, refers to a pattern of distribution where…

Q: The function of RNA polymerase is to A) catalyze the formation of phosphodiester bonds between…

A: Gene expression is the process thorough which the DNA directs to form proteins. It involves two…

Q: If a human gene is found to contain five introns, the mature mRNA encoded by that gene would have…

A: Introduction  The parts of a gene that are translated into proteins are called exons. Introns are…

Q: Explain why cell biologists predicted that the genetic code would be based on a 3-base codon.…

A: The genetic code is the precise sequence of DNA nucleotides read as three-letter words or codons…

Q: Which of the following parts of translation is significantly different in eukaryotes and…

A: mRNA or messenger RNA carries genetic information as nucleotide sequence copied from template DNA…

Q: 1)post translational  processing of polypeptide chains including…

A: Protein synthesis or translation is the process by which mRNA is translated into protein using tRNA…

Q: acid   (b) the genetic code can mutate

A: Introduction : The DNA molecule which is the genetic material, is converted to mRNA by the process…

Q: Which of these molecules would have the most monomers (i.e. be longest)? a) RNA polymer that…

A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…

Q: Match the function in translation to each type of RNA (one RNA has two listed functions). 1) Carry…

A: The process where RNA transformed into protein called translation. There are all three types of…

Q: b) What is the MRNA sequence that would be created from the DNA template sequence above?…

A: Cell is the basic structural and functional unit of life. All the cells contains the nucleus with…

Q: the gene above is transcribed into a functional mRNA, a.) how many codons will be carried by the…

A: The process of formation of messenger RNA with the help of template strand of DNA is called…

Q: They are related in str They have identical ba C) they are the result of a

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: a) Are codons found in DNA or RNA? b) How many bases are in a codon? c) Give an example of a codon.

A: A codon is a DNA or RNA trinucleotide sequence that refers to a certain amino acid.

Q: 1. If the gene above is transcribed into a functional mRNA,  a.) how many codons will be carried by…

A: a) 64 codons will be carried by the functional mRNA, 61 represent amino acids, and the remaining…

Q: 3) During charging of tRNAS Select an answer and submit. For keyboard navigation, use the up/down…

A: The translation is a process by which proteins are synthesized. It is the last step of the central…

Q: 16) PROTEIN SYNTHESIS: A) Describe the process of protein synthesis. Be sure to use transcription…

A: Proteins are polymers of amino acids formed via peptide bond between two amino acids .

Q: All of these materials are needed for translation EXCEPT: O A) TRNA O B) ribosomes C) RNA polymerase…

A: Translation, in molecular genetics, is the mechanism by which ribosomes in the cytosol or…

Q: Chloramphenicol blocks the peptidyl transferase reaction on ribosomes. The specific effect of this…

A: Transcription:  It is the process of formation of RNA transcript from DNA template by the enzyme DNA…

Q: The nearly universal genetic code consists of how many codons?

A: Genes are the unit of heredity and they are made up of triplet genetic codons. These codons are…

Q: Consider a portion of a gene in a cell with the sequence TTTTT. Which of the following bases would…

A: The correct answer is C) A-A-A-A-A; nucleus .

Q: amino acids are covalently linked to tRNAs via what  a) phosphodiester bond  b) premature…

A: Protein synthesis is governed by the genes which are present on the chromosomes. The genes are first…

Q: 1a) Name the start codon and the three stop codons for translation. 1b) What amino acid is…

A: An mRNA codon is a triplet or triple-nucleotide sequence that codes for a certain amino acid during…

Q: A ribosome binds to the following mRNA at the site indicatedby the dark box. At which codon will…

A: The mRNA strands obtained after the transcription of the antisense DNA strand (also known as the…

Q: Which of the following is a function of TRNA? O A) brings one amino acid to the ribosome B)…

A:

Q: An mRNA encodes a polypeptide that is 312 amino acids in length. The 53rd codon in this polypeptide…

A: The translation is the second part of the central dogma of molecular biology: RNA → Protein. It is…

Q: How many amino acids are coded for by one codon? O a) 1 O b) 2 O c) 3 O d) 4

A: The sequence of three nucleotides of DNA and RNA is known as Codon. There are 64 different codons…

Q: A eukaryotic mRNA has 1066 total nucleotides. 50 of these are the 5'UTR and 50 of these are the…

A: In a mature transcript, there are 5' untranslated (UTR) regions and 3' UTR which do not code for any…

Q: ) The deacetylation of histones generally causes gene inactivation. True or false?

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: and each codon is made up of three nucleotide bases. How might an extra single base INSERTION into…

A: Any abrupt changes in DNA nucleotide is called muttaion.Depending on where the changes occurred…

Q: DNA molecules consist of chemically linked sequences of the bases adenine, guanine, cytosine, and…

A: Codon is a base triplet that exists in DNA. DNA gets transcripted to mRNA which then translates to…

Q: The sequence A is read by RNA polymerase to produce an mRNA that is translated by the ribosome:…

A:

Q: An mRNA has the following sequence: 5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′ Identify the start…

A: RNA (Ribo Nucleic Acid) is the genetic material found in prokaryotes and eukaryotes. It is the prime…

Q: is the MINIMUM number of tRNA's needed to recognize all of the codons for glutamate (Glu)

A: Deoxyribonucleic Acid (DNA) is made up of four main bases, also known as nucleotides. These are -…

Q: A group of 3 nucleotides codes for one amino acid. How many codons are needed to make the…

A: Translation: The process through which RNA codes for specific proteins is known as translation. It…

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: Transcription is the process in which RNA is synthesized from DNA.

Q: The human genome has 3.3 billion bases, of which 3% codes for protein. If a codon were four letters…

A: In most organisms, genetic information is stored in the form of the nucleotide sequence of DNA. This…

Q: 5' 5' X Y 5' Codon Codon Codon Codon Codon Codon 1 2 3 4 5 6.

A: The DNA (deoxyribonucleic acid) is the hereditary unit of an organism. It consists of purines and…

Q: What does it mean when we say the genetic code is redundant?     a)  A single codon can specify…

A: DNA is the genetic material present in most of the living organisms. The DNA is made up of 4…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.