They are related in str They have identical ba C) they are the result of a
Q: ruvate through the TCA cycle. calculate the net ATPS produced from one olecule of alucose in a glyco...
A: Oxidation of glucose molecule through a combined action of glycolysis , the TCA cycle , and oxidativ...
Q: The configuration of the given structure below is: * но-сн, о OH но CH2-OH он O alpha-L O alpha-D be...
A: The isomeric units of monosaccharides that differ only in their configuration at reference carbon ar...
Q: Urease enzyme hydrolysed urea at [S]= 0.03 mmol/L with a Km value of around 0.06 mmol/L. The initial...
A: From the above data, S1 = 0.0.3 mmol/L km is around 0.06 mmol/L Initial velocity V01 = 1.5*10-3 V0...
Q: What would happen to the functionality of cholic acid if the 3 hydroxy groups were removed? A) Ther...
A: Fats are water insoluble amphipathic molecules. More than 90% of the structure of a fat is hydrophob...
Q: *Which of the following statements about allosteric enzymes is NOT true? Question 10 options: - They...
A: Enzymes are biocatalysts that increase the rate of a reaction by a factor of several. Living cells a...
Q: Please describe the biochemical processes involving hemoglobin and carbonic acid buffer system when ...
A: Buffer solutions are extremely important in biology and is necessary for the maintenance of physiol...
Q: In sample preparation for electron microscopy, arrange the following steps in correct order A. Apply...
A: Electron microscopy is the technique of visualising the structure of tissues, cells and organelles a...
Q: The first 15 bases of the original informational strand of DNA (which continues after what is shown)...
A: Mutation is the change in DNA sequence caused due to various factors. Mutations take place during DN...
Q: Arachidonic acids * A. Linoleic polyunsaturated omega-6 fatty acid is its starting material. B. Sp...
A: Lipids are not polymers. The simplest form of lipid is fatty acids which are a long chain of ...
Q: H2O2 + catalase = 2 H2O2 + O2, is an example of what enzyme specificity? * A. Stereochemical B. Gr...
A: Catalase react with h2o2 and gives water and oxygen
Q: 4. The sequence of a peptide A formed by 16 amino acids was determined using a combination of method...
A: Proteins are chain of amino acids linked by peptide bond with release of a water molecule. Alpha car...
Q: raw the structure and give the name of the pentapeptide GRAND. Encircle all peptide bonds as well
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids conta...
Q: Which of the following is an incorrect grouping of amino acids based on their properties of the side...
A: Introduction: Amino acid is a compound that contains an amino and a carboxyl group and a side-chain ...
Q: Why does it make sense that under conditions of low ATP levels in the cell the pyruvate carboxylase ...
A: Reaction catalyzed by Pyruvate carboxylase is given below; Pyruvate + CO2 + ATP + H2O →Pyruvate carb...
Q: What are the biomolecules that are used to biosynthesize a purine ring in the de novo pathway – prov...
A: Purine de novo synthesis is a time-consuming process. It happens actively in the liver cytosol, wher...
Q: Why does it make sense that under conditions of low ATP levels in the cell the pyruvate carboxylase ...
A: Glucose is degraded to pyruvate through the process of glycolysis that occurs in the cytoplasm. Pyru...
Q: Write the structure formula, three-letter and one-letter abbreviation for each essential amino acid ...
A: Amino acids contain amino group and carboxyl group along with R side chain. The R side chain defines...
Q: Cleavage of a phosphate bond is needed for de-polymerization of which mature polymer? Neither microf...
A: The eukaryotic cytoskeleton is composed of microfilaments, microtubules, and intermediate filaments....
Q: human blood plasma contains all the amino acids
A: here they are talking about amino acids present in blood plasma . so our blood plasma contains alan...
Q: Biochemistry Question: Give one example of 5-Carben Sugar
A: Introduction: A five-carbon sugar found in the DNA is deoxyribose. It forms the central molecule in ...
Q: What is the biological importance of carbon, nitrogrn and phosphorus?
A: Biomolecules are organic substances, which are majorly composed of carbon. Nitrogen and phosphorous ...
Q: Calculate the actual free energy of hydrolysis of ATP, delta Gp in the erythrocytes of a new species...
A: Actual free energy (∆G) is the maximum amount of energy which is available to perform work. Standard...
Q: Biochemistry Question: Nonenzymatic glycosylation or glycation creates glycoproteins by
A: Glycoproteins are molecules that comprise protein and carbohydrate chains that are involved in many ...
Q: Under what conditions will lactic acid accumulate in skeletal muscle? Select one: A. When NADH is d...
A: A reduction in muscle force generated over time or as a result of pathological conditions is referre...
Q: What is the Keq for the conversion of Glucose 6-Phosphate to Glucose 1-Phosphate if the phosphate tr...
A: Given- 1) Potential for Glucose 1-phsophate.- 20.9KJ/mol 2) potential for Glucose 6-Phosphate- -13....
Q: -Inhibitor +Inhibitor [S] (mM) Vο&νβσπ: (μmol/sec). Vο&νβσπ:&νβσπ: (μmollsec) 0.0001 33 17 0.0005 71...
A: From the given data, I have calculated 1/S and 1/V0 in absence and presence of inhibitor. The plot b...
Q: Below are the structures of three phosphate-containing molecules. Which one has the lowest Phosphory...
A: Phosphate group is containing one phosphate group atom attached to four oxygen molecule.Various mole...
Q: Rory’s father was working on the electrical wiring his basement. Rory noticed that his father wore r...
A: Rory's father was wearing rubber gloves, which are known to be one of the defense mechanisms while w...
Q: Which of the followingdescribe superior properties of enzymes (biological catalysts) over traditiona...
A: Enzymes are biocatalysts that are protein in nature. They Enzymes present a the particular substrate...
Q: *Which of the following statements about allosteric enzymes is NOT true? Question 10 options: - They...
A: Enzymes are protein molecules that increase the rate of reactions by decreasing the activation energ...
Q: Which of the below statements is correct regarding tertiary structure? All are correct Disulfide bon...
A: A protein has four structural levels of organization – primary, secondary, tertiary and quaternary P...
Q: Unfolding of a protein can be termed as a. Reduction b. Oxidation c. Denaturation d. Renaturation
A: Proteins have different levels of structural organization. They are, Primary structure Secondary st...
Q: Which of the following condition is NOT associated with riboflavin deficiency? * (Please choose one ...
A: Riboflavin is a water soluble vitamin. It is also called as B2 vitamin. Foods like pork, eggs, chees...
Q: A pyrimidine(s) with a H-bond acceptor its middle position is/are a Cytosine b Uracil c ...
A: Hydrogen bond donor is the atom that do not provide a hydrogen atom for hydrogen bonding. They mig...
Q: *Which of the following statements about allosteric enzymes is NOT true? Question 10 options: - They...
A: Ezymes are boost up chemical reaction in body.allosteirc enzyme are type of Ezymes.Allosteric enzyme...
Q: What is/are the end product(s) of protein digestion?
A: Disclaimer: “Since you have asked multiple question, we will solve the first question for you. If yo...
Q: Using a semi-permeable membrane, dialysis allows the removal of salt ions prior to chromatography. T...
A: Dialysis is a separation process that uses selective and passive diffusion via a semi-permeable memb...
Q: 1. Which of the following molecule can act as molecular chaperons for assisting the folding of prote...
A: A broad set of unrelated protein families whose function is to stabilise unfolded proteins, unfold t...
Q: Match the following: choices: transcription factor
A: Transcription is the process of synthesizing RNA from genetic information stored in DNA. There are m...
Q: *Which of the following statements about allosteric enzymes is NOT true? Question 10 options: - They...
A: Allosteric enzymes have binding sites other than active sites for the regulator molecules that activ...
Q: 1. Draw NEW amino acids; name them and characterize them 2. Make two dipeptides with your two new am...
A: Amino acids contain amino group and carboxyl group along with R side chain. The R side chain defines...
Q: ideroblastic anemia is observed in the deficiency of which of the following? * (Please choose one co...
A: Vitamins are the organic compounds required for the proper functioning of the body. The vitamins are...
Q: All the dehydrogenases of glycolysis and the citric acid cycle use NAD+ (E°' for NAD+/NADH is -0.32 ...
A: NADH/FADH2 are also known as reducing equivalents. These reducing equivalents are produced in the gl...
Q: What level(s) of protein structure is(are) ordinarily disrupted in denaturation? What level(s) is(ar...
A: In an amino acid-chain molecule, protein structure refers to the three-dimensional arrangement of at...
Q: (a) A solution containing these five proteins was adjusted to pH 7.0 and then applied to a SIZE-EXCL...
A: Chromatography is a method of separation of specific compounds from the mixture of compounds. This c...
Q: Bradford technique makes use of the Coomassie blue dye that binds to the protein, with the complex a...
A: Coomassie blue is disulphamide triphenyl methyl compound.Coomassie dye binds to proteins through ion...
Q: structure of phenol derivatives @ #6-9,
A: Phenol derivatives are found with important activity such as an antioxidants, anti-cancer, disinfeci...
Q: The cofactor shown below: NH2 NH2 он -O- он он 1) is an oxidizing agent O 2) is a reducing agent O 3...
A: A cofactor is a non-protein chemical molecule or metallic ion that is required for an enzyme to perf...
Q: Compare the differences in the techniques used in whole genome shotgun sequencing and next generatio...
A: The process of determining the exact order of nucleotides in a gene, a cluster of genes, a chromosom...
Q: Failed to follow
A: Waxes are a broad category of organic compounds that are lipophilic and bendable solids at room temp...
Step by step
Solved in 2 steps
- A segment of DNA has the followimg sequence of bases.. 5'-ATGCAATGATATTGAAGCTTA-3' a) What sequence of bases would appear in mRNA transcribed from this segment? b) Assume the first base in this mRNA is the beginning of a codon. What order of amino acid would be translated into a polypeptide synthesized along this segment? c) Give anticodons for each tRNA associated with the translation in part (b)(a) Write the complementary base sequence for the matching strand in the DNA section shown below:. 5’ – A T G T T A C T A G T C – 3’ (b) The following section of DNA is used to build an mRNA for a protein: 3′—AAG—CTT—CTC—5′. What is the corresponding mRNA sequence?Gene editing is also used to explore the structure and function ofproteins. For example, changes can be made to the coding sequenceof a gene to determine how alterations in the amino acid sequenceaffect the function of a protein. Let’s suppose that you areinterested in the functional importance of a particular glutamicacid (an amino acid) within a protein you are studying. By geneediting, you make mutant proteins in which the glutamic acidcodon has been changed to other codons. You then test the encodedmutant proteins for functionality. The results are as follows: FunctionalityNormal protein 100%Mutant proteins containingTyrosine 5%Phenylalanine 3%Aspartic acid 94%Glycine 4%From these results, what would you conclude about the…
- Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which prevent ions from moving across cell membranes. Normally there are channel proteins that allow passage of the ions, but in patients with one kind of CF these proteins seem odd. Closer examination shows that these proteins display the correct amino acid sequence. However, they fail to do their job. A) Given that the primary structure of the protein is correct, what can you infer about the DNA sequence for the gene coding this protein on this patient, is there a mutation? Explain. B) Why is the primary structure insufficient to guarantee the proper function of the protein?Consider a short peptide that forms an alpha-helix within a larger protein structure. Suppose that one glutamate residue at some specific position in the helix were mutated to a leucine residue. The mutation could either make the helix more stable, or less stable. i) Describe two situations in which a Glu-to-Leu mutation could make the helix more stable. ii) Describe two situations in which the Glu-to-Leu mutation could make the helix less stable. Explain briefly the basis for the stabilizing and destabilizing effect in all cases.A DNA strand consists of any sequence of four kinds of nucleotides. Suppose there were only 14 different amino acids instead of 20. Which of the following statements would be correct descriptions of the minimal number of nucleotides necessary to create a genetic code? a) 1 b)2, provided that chain termination does not require a special codon c) 3, provided that chain termination does require a special codon d)2, no matter how chain termination is accomplished e) Both b and c
- The genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?Which of the following best describes a stop codon? A) They are codons that indicate termination of protein synthesis. B) They are codons that are extra in the genetic code and are not used. C) They are codons that indicate when to create new peptide bonds. D) They are codons that signal when the RNA strand is done being read. E) They are codons that indicate when to begin folding the polypeptide.Shown below is an internal fragment of a polypeptide. If this polypeptide were growing, onto which end would the next amino acid be added? a) Onto the right b) Onto the left
- 3)Which of the following statements are true? Choose all that apply a)There are multiple codons possible for nearly all amino acids b)Each stop codon also codes for an amino acid c)Each tRNA will base pair with only one codon d)The start codon also codes for an amino acid e)Each codon in mRNA codes for exactly one amino acid f)Each codon in tRNA codes for exactly one amino acid g)Each anticodon in tRNA pairs with exactly one codon h)Each tRNA carries exactly one type of amino acidHow the mutations change chemical nature of R group of amino acids? (like polar nonpolar/ charged uncharged) And predict if those changes affect the protein function strongly? Or only weak effects? a)Glutamate to lysine b)asparagine to tyrosine c) aspartate to glutamate thankswhich statement about genetic code is not true? A) mRNA is read 3 bases at a time, which are called codons. B) There is one initiator codon that codes for an amino acid. C) Each amino acid is coded for by only one codon. D) There are 3 termination codons that do not code for amino acids. E) Each codon is specific for only one amino acid. An anion has an equilibrium potential of -40 mV. What direction are the chemical and electrical forces acting on the anion at the resting membrane potential (-70 mV)? A) Both the chemical and electrical forces are directed out of the cell. B) The chemical force is directed out of the cell and the electrical force is directed into the cell. C) The chemical force is directed into the cell and the electrical force is directed out of the cell. D) There is insufficient information to answer this question. E) Both the chemical and electrical forces are directed into the cell.
