The chromatogram shows fluorescent peak data from a dye-terminating nucleotide-sequencing reaction. The peaks are shown with shortest fragment on the left to longer fragments on the right. -G - T •C A Select the DNA sequence that matches the data. 5-ТАТАСТТАСGAAGT-3' 5'-GTCCTACGGACGCG–3' 5-АТАTGAATGCTTCA-3' 5-TGAAGCATТСАТАТ-3' 5'-ACTTCGTAAGTATA-3'

Q: The following is the base sequence of DNA that codes for first eight amino acids of the β chain of…

A: As per the bartleby guidelines experts are allowed to answer only 3 sub-parts for a question. The…

Q: For a DNA sequence 5'-CTAAGCCGGAT-3', what is the complementary DNA sequence?   Question 6…

A: DNA or Deoxyribonucleic acid serves as the hereditary material of almost all living entities (some…

Q: Second Base Analyze the following DNA sequences: A UUU UCU UAU UGU Phe Tyr UUC UCC UAC UGC Original:…

A: So, the given information is:- ORIGINAL- AGAGAGAGAGAGAGAGAG…

Q: The following DNAs were incubated with E. coli DNA Polymerase I and dNTPs. Write the products…

A: DNA replication is the process by which new DNA is synthesized from the old DNA by semiconservative…

Q: B. How many non-covalent hydrogen bonds stabilize this structure? 8 C. How many covalent phosphate…

A: The trinucleotide sequence is:5' - ACG - 3'The complementary trinucleotide sequence will be:3' - TGC…

Q: 5' AU Py U A AGGCC G. UGGC G C G GGG What modified nucleoside base is indicated by the arrow?…

A: The answer of the above question is : Pseudouracil (Ψ). Pseudouridine (psi- Ψ)is an isomer of the…

Q: Take each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication…

A: A set of guidelines known as the genetic code controls how genetic information is converted from DNA…

Q: functions. The structure that provides high processivity (processivity factor) is represented by the…

A: Letter A denotes core polymerase enzyme B denotes tau protein C denotes gamma clamp loader D denotes…

Q: The following are DNA fragments containing a small gene.  The top strand is the coding strand.…

A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…

Q: The gel pattern below was produced by the Sanger sequencing method. Determine the sequence…

A: In sanger Sequencing, the products of the nucleotides A, G, C, and T reactions are individually…

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: The central dogma is DNA --> mRNA --> Protein. Hence, any mutations in the DNA lead to changes…

Q: Restriction enzyme:   Recognition sequence:     Number of pieces of DNA:  Type of cut:

A: In the question a DNA sequence is given with its nucleotides.  Restriction enzyme is an enzyme that…

Q: SARS-CoV-2 virus infection. Your advisor gives you the double-stranded DNA sequence encoding Peptide…

A: Transcription is the process of formation of a sequence of RNA using DNA as a template. Translation…

Q: Use the gel to answer the following questions. You will be constructing a map of the plasmid,…

A: Plasmids have been used in genetic engineering for cloning and expression. These carry the genes for…

Q: Acyclovir can be used to treat severe cases of Epstein-Barr viral (EBV) infection, but has little to…

A: Introduction:Acyclovir is an antiviral drug commonly used to treat infections caused by…

Q: You digest 4 uL of plasmid DNA that is 50 ng/uL concetration in a total volume of 20 uL. You run 10…

A: ANSWER) The amount of DNA digested can be calculated as follows: Total amount of DNA = volume x…

Q: EcoRI --- 5' G - AATTC 3'       5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3'     3'…

A: The DNA is formed of several repeating units of monomers called nucleotides. The adjacent…

Q: EcoRI recognizes G A-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments…

A: A restriction site or recognition site, is a specific sequence of nucleotides in DNA that a…

Q: 5'- ATG CTG TTT GTA CGG GÁC TAA-3' a) Write out the DNA template side for the DNA coding side above?…

A: Introduction The term template strand refers to the sequence of DNA that is copied during the…

Q: sing the genetic code provided what would be the corresponding polypeptide sequence for the DNA…

A: The DNA is transcribed into the RNA by the process of transcription and the RNA is translated into…

Q: Why is the company Qiagen has more refined DNA extraction steps than a normal Strawberry DNA…

A: DNA extraction procedure refers to the methodology that is followed to purify the the DNA (cellular…

Q: You are studying a protein that contains the peptide sequence RDGSWKLVI. The part of the DNA…

A: The restriction endonuclease are responsible for cutting the DNA at specific sequence and they…

Q: Which well(A through E) of this agarose gel contains the smallest DNA size? Please look at the pic.

A: Gel electrophoresis technique of separation of molecules on the basis of their size and charged…

Q: Given the DNA template strand 3' GCATTCAAG 5', write the amino acid sequence in the N‑terminal to…

A: Amino acids are the basic units (monomers) that makeup proteins. They consolidate to frame short…

Q: 3000 bp 2000 bp 1000 bp 800 bp 700 bp 500 bp L Uncut EcoRI BamHI Ncol EcoR1/BamH1 BamHI/Nco1…

A: Plasmids are double-stranded circular DNA molecules. Due to their small size and stability, these…

Q: You dilute 10 µL of your isolated DNA with 90 µL of water. You then measure and record the…

A: To calculate the concentration of the plasmid DNA in μg/mL, we can use the following…

Q: You will be setting up your diagnostic digest on three plasmids, the ones you began with, PGFPUV and…

A: In this question, we have to complete the table for the reaction mixture of a PCR experiment.

Q: Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT

A: By the process of transcription the DNA strand is transcribed into mRNA within the nucleus of the…

Q: Answer the following 2 questions based on the given sequence of DNA. The top strand is the template…

A: The central dogma of DNA consists of transcription and translation. In transcription, the DNA makes…

Q: A lagging strand is sketched below. The Okazaki fragment DNA is red, and the RNA primers are dashed…

A: DNA replication is the cellular process that involves production of new DNA from the old DNA…

Q: The coding (sense) strands of several DNA molecules have the base sequences in the table below.…

A: The melting temperature of a DNA depends on the number of hydrogen bonds that bind these double…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.