T0.5 STRUCTURE O 30 nm 30 nm 30 nm Histone- octamer (a) Micrograph of (b) Solenoid model (c) Zigzag model a 30-nm fiber FIGURE 10.13 The 30-nm fiber. (a) A photomicrograph of the 30-nm fib (b) In the solenoid model, the nucleosomes are packed in a helical configuration. (c) the zigzag model, the linker DNA forms a more irregular structure, and less contact curs between adjacent nucleosomes. The zigzag model is consistent with more recen data regarding chromatin conformation. (a): © Jerome Rattner/University of Calgary

T0.5 STRUCTURE O 30 nm 30 nm 30 nm Histone- octamer (a) Micrograph of (b) Solenoid model (c) Zigzag model a 30-nm fiber FIGURE 10.13 The 30-nm fiber. (a) A photomicrograph of the 30-nm fib (b) In the solenoid model, the nucleosomes are packed in a helical configuration. (c) the zigzag model, the linker DNA forms a more irregular structure, and less contact curs between adjacent nucleosomes. The zigzag model is consistent with more recen data regarding chromatin conformation. (a): © Jerome Rattner/University of Calgary

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter14: Dna Structure And Replication

Section: Chapter Questions

Problem 10TYK

See similar textbooks

Similar questions

(A) Give the polypeptide translation of the RNA sequence below. 5’-AUGGAAAUCAAAGUCAACCUUGAGUUUAGA-3’ (B) Write the chemical structure of the polypeptide sequence you determined in part (a) (C) Given the chemical structure of the polypeptide sequence you have written in part (b), answer True or False for each of the 5 statements below. (1) At least one of the amino acids in the sequence can undergo phosphorylation (2) The sequence looks like it could form a β turn (3) The sequence looks like it could form a β strand with one surface facing the interior of the protein and the other surface exposed to water (4) At least one of the amino acids in the polypeptide sequence can undergo oxidation to form a disulfide bridge to another polypeptide (5) The sequence looks like it could form an α helix that would be part of a coiled coil structure within a protein
(a) Draw the structure of the high-energy nucleoside triphosphate GTP. (b) Draw the structure of the hydrolysis product formed when one phosphate is removed.
Figure 1 shows the structure of adenine and thymine. (i) (ii) NH adenine C-H thymine Figure 1 Illustrate the potential tautomers of adenine and thymine. Draw a chemical structure of Thyminc-Adenine (T-A) base pair and label the patterns of hydrogen bond acceptors, donors in the major groove of the TA base pair.
7. 1 B e here to search Required Study the two diagrams below. Diagram A 2 1 Diagram B 2 Based on the sequence of steps (1, 2, 3), which of the diagrams shows what would happen to proteins made at the ribosomes and transported to the outside of the cell? Diagram A Diagram B Both Diagram A and Diagram B Neither Diagram A nor Diagram B DELL 40)
(a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5' GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5' GTCCCATACGTAGCCGTAGGACATGTACCG 3' Y 5' CGGTACATGTCCTACGGCTACAATGCGATC 3' Z 5' TTACAGTGGACCTACGGCTACGTATGGGAC 3' I and 21
6
Suppose you have two genetic variants of a large protein that differ only inthat one contains a histidine (side chain pKa = 6.0) when the other has avaline (uncharged side chain).(a) Which would be better for separation: gel electrophoresis or isoelectricfocusing? Why?(b) What pH would you choose for the separation?
what are we looking at in part (b)? Is this an11-nm fiber, a 30-nm fiber, or a 300-nm fiber? Does this DNAcome from a cell during M phase or interphase?
In the context of cell biology, what do we mean by form follows function? What are at least two examples of this concept?
Bacteriorhodospin (Mw = 26 kDa) is a protein with purple colour. The protein acts as a light-activated proton pump that provides energy for cellular functions. The structure, revealed by both electron microscopy and X-ray crystallography, showed that the protein consists of 7 transmembrane spanning helices (TMH). Each TMH traverses the lipid bilayer completely (thickness of 45 Å). a)Calculate the minimum number of amino acid residues needed per TMH to completely cross the membrane. b)Estimate how large a fraction of the bacteriorhodopsin protein that is made up by TMHs. c)Now that you know the fraction of the protein that is made up by TMHs, at which ψ/φangles will the amino acids cluster in a Ramachandran plot?
i. A schematic structure of the subunit of hemerythrin (an oxygen-binding protein from invertebrate animals) is shown to the right. (a) It has been found that in some of the a-helical regions of hemerythrin, about every third or fourth amino acid residue is a hydrophobic one. Suggest a structural reason for this finding. (b) What would be the effect of a mutation that placed a proline residue at point A in the structure?
TERTIARY STRUCTURE (A) (B) (C) Fg Eet Galand Sen 20e Figure 6. Examples of the arrangement of a-helices and B-sheets in folded protein domains. Copyright 2013 from Essential Cell Biology, 4th Edition by Alberts et al. Reproduced by permission of Garland Science/ Taylor & Francis LLC. Figure 6 shows three examples of how secondary structure elements can be arranged in relation to one another in the functional, folded form of a complete protein or one compact portion of a protein. The overall three-dimensional shape (or conformation) of a protein is its tertiary structure. • What do you think holds together the various secondary structural elements in a particular three-dimensional pattern? (Hint: Look back at Figure 5 - what is sticking out from the sides of the a-helices and B-strands?)