Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAG TTA AGG CTC CTA GGT TA 5' a. What would be the first 5 bases at the 3' end of the complementary strand? b. What would be the first 10 bases at the 5' of the complementary strand?

Q: B. How many non-covalent hydrogen bonds stabilize this structure? 8 C. How many covalent phosphate…

A: The trinucleotide sequence is:5' - ACG - 3'The complementary trinucleotide sequence will be:3' - TGC…

Q: Create the complimentary strand for the DNA strand below. Make sure to label the parts and…

A: DNA molecules store genetic material and two primary processes are necessary in order for DNA to…

Q: One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base…

A: DNA stands for deoxyribonucleic acid and is found in the nucleus of eukaryotic cells and in the…

Q: E D A 11. Ligase is denoted by letter 12. The Okazaki fragment is denoted by letter . 13. The SSB…

A: DNA (Deoxyribonucleic acid) and RNA are two examples of nucleic acids (Ribonucleic acid).…

Q: Assume the energy of hydrogen bonds per base pair to be 5.86 kJ-mol-1. Given two complementary…

A: Given Energy of H-Bond per base pair = 5.86 kJ mol-1 Number of Base pair in complementary DNA = 145…

Q: In the Watson-Crick model of DNA structure:   Question 5 options:   T can form three hydrogen…

A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: (iij If one of the strands of DNA has the following sequence of bases running in the 5'3' direction…

A:

Q: You will start off by laying out your individual nucleotides for the first strand using the…

A: DNA is a macro molecule or a polymer which is made up of a monomer called nucleotides. Each…

Q: One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base…

A: Introduction DNA is the molecular structure that is composed of a pair of polynucleotide chains…

Q: 5’ TAAGCGTAACCCGCTAA   CGTATGCGAAC   GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT   GCATACGCTTG…

A: The DNA is a double stranded molecule which are paired along with a complimentary strand. The above…

Q: Consider a portion of double-stranded DNA with the complementary sequence of base pairs shown. Write…

A: DNA is genetic material in most of living organisms. There are four nitrogenous  bases present in…

Q: The complementary strands of DNA in the double helixare held together by hydrogen bonds: G ≡ C or A…

A: DNA double helix is formed by the hydrogen bonds formed between the base pairs. Adenines forms two…

Q: phosphodiester bonds 8 0-2-0-3 O HCS H₂C 8-6-0 H₂C OH O 0-6-0 H₂C OH O 2 purine pyrimidine T Strand…

A: DNA (Deoxyribonucleic Acid) is a double-stranded structure that carries the genetic instructions of…

Q: Draw the following strands of DNA 5’ C-A-T 3’ as well as the complementary base pairing strand…

A: Two strands of DNA twist around one another to form a double helix DNA and both are in anti-parallel…

Q: Which of the following descriptions of regions A, B, and Care INCORRECT? A = minor groove, sugar…

A: On one side of the helix, the strand backbones are closer together than on the other. When the…

Q: If the following piece of the partially double stranded DNA: 5' ATCG 3' 3' TAGCGGCATCCG 5' and…

A: Given:  A piece of the partially double-stranded DNA: 5' ATCG 3' 3' TAGCGGCATCCG 5' and add DNA…

Q: Give

A: Introduction:- The central dogma of biological sciences explains how genetic information is…

Q: Using the Figure below identify: What is the significance of hydrogen bonds in double helix of DN…

A: Deoxyribonucleic acid, or DNA, is a molecule that holds the information that allows an organism to…

Q: I need help because i don't get it. Can you help me to explain to me, please?

A: DNA It refers to the molecule that constitutes genetic information that is passed from generation ot…

Q: Which of the following substances is involved in de novo synthesis of purine nucleotides but not…

A: Metabolism is the sum total of all chemical transformations taking place within an organism. Most of…

Q: Consider the RNA sequence 5' AUGUUAGAUCGG 3' transcribed from the DNA molecule below. 1. 5'…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: ’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ Fill in the complimentary DNA strand and…

A: Watson and Crick elucidated in 1953 , the famous double stranded structure of the DNA molecule and…

Q: Examine the 5 -3' sequence of bases of the DNA molecules (A D) shown below. I am only showing you…

A: For option A, AAAT the complementary strand is TTTA. In this A pairs with T by two hydrogen bonds…

Q: A. DNA Replication Construct a DNA with 15 base pairs. (Note that the first three nucleofides of the…

A: DNA(Deoxy ribonucleic acid) is a double stranded helical structure which is made up of phosphate…

Q: A lagging strand is sketched below. The Okazaki fragment DNA is red, and the RNA primers are dashed…

A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: It has been estimated that each phosphate group in B-DNA can form hydrogen bonds with six water…

A: The double-helical structure of DNA which is right-handed with 10-10.5 base pairs in a single turn…

Q: a.Write out the complementary strand to the following sequence. Begin with the 5' of the end of the…

A: The Nucleotides polymers that are responsible for determining and regulating the genetic…

Q: The single strand of DNA below forms a stem-loop structure structure with a loop that is 6…

A: The answer will be b) 5' CTACGATA 3' As in this option 5 nucleotides from 3' end are complimentary…

Q: On paper, replicate the following segment of DNA:            5’ A T C G G C T A C G T T C A C 3’…

A: DNA replication is a complex process of producing copies of the entire chromosome using the…

Q: Explain how DNA-binding proteins can make sequence-specific contacts to a double-stranded DNA…

A: Introduction DNA is an organic chemical that contains genetic information as well as instructions…

Q: Given the following template DNA strand, what is the correct complementary DNA sequence? 3' CGC AGT…

A: Nucleic acids are present inside the nucleus to store and pass genetic information and thus controls…

Q: One of the original structures proposed for DNA had all the phosphate groups positioned at the…

A: A structure for nucleic acid has already been proposed by Pauling and Corey. Their model consists of…

Q: Consider the following DNA strand with the following nucleotide sequence: 3’-ATATCAGAGAATATCA-5’…

A:

Q: he sequence of the DNA template strand is 3’– GACTTCC – 5’ What is the sequence of the DNA…

A: DNA (Deoxyribonucleic Acid) It is defined as a genetic material which has all the stored genetic…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.