Are the bands indicated in Step 6 (SDS-PAGE) likely visualized by western blot or by a general protein stain (such as Coomassie or silver)? **Title: Epitope-Tagged Protein Interaction Study Workflow****Introduction:**The figure illustrates a multi-step process used to study protein interactions using an epitope-tagged protein expressed in cells. Below is a detailed description of each step, accompanied by explanations of the graphical elements.**Step-by-Step Workflow:****Step 1: Epitope-Tagged Protein (Encoded by cDNA)**- **Description:** The process begins with the epitope-tagged protein, which is depicted by a rectangular yellow icon labeled "YFP" (Yellow Fluorescent Protein).- **Graphical Element:** The yellow rectangle with "YFP" inside.**Step 2: Transfection into Cells**- **Description:** The cDNA encoding the epitope-tagged protein is transfected into cells, facilitating the expression of the tagged protein within them.- **Graphical Element:** A stylized cell showing various molecules including the YFP-tagged protein, indicated as a yellow point within the cell.**Step 3: Lyse Cells**- **Description:** The cells are lysed to release their contents, including the YFP-tagged protein and associated complexes.- **Graphical Element:** An arrow from the cell to the next step, indicating the cell lysis process.**Step 4: Affinity-Based Purification Using Immobilized Antibody Against the Epitope**- **Description:** The YFP-tagged protein and its associated complexes are captured using antibodies immobilized on a solid support targeted against the epitope.- **Graphical Element:** A column representation with an immobilized antibody capturing the YFP-tagged protein and its interacting partners (colored shapes A, B, C, D).**Step 5: Competitive Elution with Peptide Encoding the Epitope**- **Description:** The YFP-tagged protein along with its associated complexes (A, B, C, D) are eluted using a competing peptide encoding the same epitope.- **Graphical Element:** An arrow representing the competitive elution process, showing the YFP and the associated proteins being released.**Step 6: Gel Electrophoresis**- **Description:** The eluted components are separated by gel electrophoresis, allowing for the analysis of different proteins based on their size.- **Graphical Element:** A gel with distinct bands corresponding to the YFP-tagged protein and associated proteins (A, B, C,

Protein is a polymer formed from amino acid joined by peptide bond. It is abundantly found in the…

STEP 1 YFP Trarsfect into ouilts STEP 2 Epitope-tagged protain (ancoded by eDNA) STEP 3 Lyse calls YFP Competitive eluion with peptide encoding the epitope YFP Gel elactrophoresis A YFP A B STEP 5 STEP 6 Afinty-based purification uang immobilized artibody against the epitape STEP 4 Excise bands end analyze by mass spactrometry STEP 7

STEP 1 YFP Trarsfect into ouilts STEP 2 Epitope-tagged protain (ancoded by eDNA) STEP 3 Lyse calls YFP Competitive eluion with peptide encoding the epitope YFP Gel elactrophoresis A YFP A B STEP 5 STEP 6 Afinty-based purification uang immobilized artibody against the epitape STEP 4 Excise bands end analyze by mass spactrometry STEP 7

Intro To Health Care

4th Edition

ISBN:9781337338295

Author:Mitchell

Publisher:Mitchell

Chapter23: Performance Improvement And Customer Service

Section: Chapter Questions

Problem 1PSP

See similar textbooks

Similar questions

INSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: Heterogenous RNA is a term that refers to mRNA that has not been processed STAMENT 2: If the %A of a bacteria is 20%, the amount of guanine is 30% STAMENT 1: A frameshift mutation involves a change in the reading frame used in the translation of an mRNA STAMENT 2: The genetic code is specific because each codon specifies only for one amino acid STAMENT 1: Binding of RNA primer to the DNA is the first step in the transcription cycle STAMENT 2: Translation refers to the synthesis of proteins using the information contained in mRNA
Instructions: Express your own gene! (1) Make up a DNA sequence of at least 18nucleotides and then (2) show the mRNA sequence that will be made via transcription,(3) show the tRNAs that will base pair and deliver the amino acids, and (4) the aminoacid sequence of the resulting protein. You can use the single letter abbreviations forDNA and RNA nucleotides and the three-letter abbreviations for the amino acids.
INSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: RNA splicing is the step in post transcriptional processing where intervening sequences are removed STAMENT 2: 5’ to 3’ direction is the direction of growth of the peptide chain ANSWER: STAMENT 1: The enzyme that joins the gaps in newly synthesized DNA is called DNA polymerase STAMENT 2: The name of the compound formed when cytosine is bonded to ribose is cytidine ANSWER: STAMENT 1: Codon is a term that refers to the 3-nucleotide code for amino acids in mRNA STAMENT 2: Transition is a kind of mutation where a purine changes to another purine ANSWER:
BL1250 Group activity 4 2020 (1) – Saved to my Mac v Mailings Review View Tell me EXERCISE 4 QUESTIONS 1. TRANSCRIPTION: Much research effort has been invested in understanding how transcription is regulated, because this process is very important for determining cell function. Transcription is a major on/ off switch for genes, providing the instructions for translation and determining the types and amounts of proteins made in a cell at a specific time. The Zebrafish is a model organism for research, and many biologists study how the regulation of genes affects the development of the zebrafish embryo. The effects of a variety of experimental conditions on zebrafish embryos can be easily visualized by light microscopy, because the outer covering (chorion) and the embryo are both transparent. See an images of zebrafish embryos at different time points in development and the adult form below. 0h Os 0.75 h 2h 3.25 h 8 h 16 h 24 h 72 h Adult -3 months (not to scale) Image from:…
Question:- How is the assembly of an antibody different than traditional forms of alternate splicing?
Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC Are there homologues for the identified gene in other systems? Identify one homologue in a invertebrate system (if there is none, provide a vertebrate homologue). What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease etc.) of the protein(s) encoded by the gene.
Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC 1. Identify the gene from which the querysequence originates (Name of gene) 2. Provide the FULLprotein sequence encoded by the gene. 3. Are different splice variants known for this gene? 4. What human disease has been connected to this gene? 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.
INSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: If 3’ ATTG 5’ is transcribed, the complementary strands is 5’ UAAC 3’ STAMENT 2: Guanine and Cytosine are purine bases ANSWER: STAMENT 1: The general term for the enzyme that connects nucleotide triphosphates in DNA is DNA transferase STAMENT 2: The enzyme that unwinds the double stranded DNA is topoisomerase ANSWER: STAMENT 1: The name of the compound formed when uracil is bonded to ribose is uradine STAMENT 2: The piece of nucleic acid that is complementary to the DNA template and serves as a starting point of replication is called RNA promoter ANSWER:
Need help:, The rRNAs are isolated from the large subunit of a bacterial ribosome and separated by density gradient centrifugation. Draw the resulting density gradient and label the bands observed. Which rRNA is longest?
Describe briefly how MALDI and two-dimensional poly acrylamide gel electrophoresis could be used to identify a protein expressed in cancer cells but not in normal healthy cells.
GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…
Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC Provide the FULL protein sequence encoded by the gene. Are different splice variants known for this gene?