states the five functions of a globular protein and an example for each
Q: The hydrolysis of ATP has an enthalpy and entropy of -24.3 kJ/mol and +21.6 J.K-1.mol-1,…
A: ATP (Adenosine Triphosphate) is an important molecule in living organisms as it provides energy for…
Q: Question 1 For import into the nucleus, proteins require: Ran-GTP active transport Pex5 an NES…
A: The nucleus is the compartment that is generally found in the centre of a eukaryotic cell and houses…
Q: Draw a schematic diagram illustrate the interactions made between the key components of total and…
A: Ligand and protein binding is vital phenomenon in our body for enzyme-substrates, enzyme-inhibitors,…
Q: Which fibrous protein is found in connective tissue and consists of 3 left-handed helices twisted…
A: Fibrous proteins are a large class of proteins which provide strength and/or flexibility to the…
Q: he initial velocity data shown in the table were obtained for an enzyme. Each assay at the…
A: Michaelis-Menten described the relationship between reaction velocity and substrate concentration.…
Q: Synthesized proteins are processed either inside the organelles or in the cytoplasm True…
A: Proteins are the biological molecules with great diversity in structure and function. They are made…
Q: Which of the following structures represent the same carbohydrate? CHO HO но- -Н EX Н -OH HOCH2 1…
A: Carbohydrates are polyhydroxy aldehydes or ketones. The general formula of carbohydrate is (CH2O)n.…
Q: Which of the following is NOT a true statement about the diagram below? Intermediate A Pathway…
A: Enzymes are the biocatalysts that mediate the biochemical reactions of metabolic pathways. They have…
Q: 1. What are buffers? 2. Using the pH scale, describe how you can indicate if the blood solution is…
A: Buffers are chemical systems which allows a solution to have a stable pH. Most buffers can help…
Q: 3. With the help of the internet and your textbook, hand-draw the chemical structures of the…
A: Drugs are chemical substances that are used to treat infection, disease or a wound. Drugs are…
Q: Calculate hematocrit for Susie's whole blood sample, given the following information: RBC volume =…
A: Introduction Whole blood is composed of erythrocytes (RBC), platelets and leukocytes (WBC). The…
Q: The reaction S-> P is catalyzed by an enzyme that follows Michaelis-Menton kinetics. From the…
A: The rate of enzyme catalyzed reaction that is the enzyme kinetics can be expressed by the…
Q: 2. The amino acid side chain residues in an a helix point center of the helix. A) Outward B) Inward…
A: Proteins have four level of structures. Primary structure Secondary Structure Tertiary Structure…
Q: Scope of Industrial biochemistry
A: Industrial biochemistry: The practice or application of set of chemical processes that occur within…
Q: Describe how each of the following relates to protein configuration: primary structure - secondary…
A: As per the central dogma of molecular biology, DNA contains the code that is necessary for the…
Q: The folding of an unfolded protein proceeds from low entropy disordered state to a single high…
A: Many proteins achieve their natural conformations in a matter of milliseconds or less. This is due…
Q: Consider a peptide with the sequence Ala-Glu-Arg-Leu. Assume the ionizable groups have the pKa…
A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…
Q: 1.In this model, the substrate still needs to fit into the enzyme like a key, but instead of simply…
A: Since you have posted multiple questions, we will provide the solutiononly to the first five…
Q: 10. Coenzyme used in electron transport. 11. It contains an apoenzyme and a metal ion cofactor. 12.…
A: Enzymes are high molecular-weight proteins that catalyse biochemical reactions. They are also called…
Q: Given the lipid structure below, part A was derived from __________ while part B was derived…
A: Glycerophospholipids have a structure similar to triacylglycerides, except that they are polar. They…
Q: Which of these is not a suitable test for assessing folate status? red cell folate plasma…
A: Folate formerly known as folacin is a water soluble vitamin B or B9 usually found in some foods…
Q: lon X has an equilibrium potential of Ex = -50 mV. At the resting membrane potential (-70mV), which…
A: Ions can move either way across a membrane but the direction of movement depends on membrane…
Q: What is ATP? Explain in two sentences. 2. How is ATP produce in Glycolysis? Kreb Cycle? Electron…
A: Individual cells release energy through the process of cellular respiration, which involves the…
Q: Enzymes are essential to the processes of photosynthesis and cellular respiration. Names two factors…
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: What is the abbreviated name of the human gene that contains the CAGATTGTGAAGAGGTCTCTTGA? following…
A: Nowadays there are various tools that are used in bioinformatics to find out the gene from the gene…
Q: The steroid progesterone has an important role in the female reproductive system. Researchers…
A: “Since you have asked multiple questions, we will answer the first and third questions. If you want…
Q: 1. 2. 3. Why does casein precipitates upon the addition of acetic acid? Why is milk used as an…
A: Casein is a phosphoprotein found in milk and so also called as milk protein. It has an isoelectric…
Q: Question 22 Each GroEL subunit has an ATP-binding pocket that catalyzes hydrolysis of its bound ATP…
A: GroEL-ES is a molecular chaperone complex assit in folding of cellular proteins. GroEL is composed…
Q: 1. what is the reason why lactose is considered to have the least sweet taste from all other kinds…
A: Carbohydrates are one among the 4 classes of biomacromolecules. Based on the number of units…
Q: Tyrosine is considered to be non-essential in the diet. Please explain what that means and what…
A: Proteins are made up of molecules called amino acids. Proteins and amino acids are the components of…
Q: RC B H₂N-C- C A B H This content is protected and may not be shared, uploaded, or distributed. C A D…
A: Amino acids are the building blocks of protein. Structurally they contain compounds such as carbon,…
Q: Identify the major and minor grooves in the DNA molecule PDB ID 141D. In addition, one end of a…
A: DNA is two strands of polynucleotide linked to each other in an antiparallel direction by hydrogen…
Q: Sulfur compounds give onions their unique flavor and properties. Compound 1 is the starting material…
A: Allinase is an enzyme which catalyzes a biochemical reaction in which S-alkyl-L-cysteine S-oxide…
Q: How much 3x loading dye should be added to 24 uL of DNA? Report you answer in units of uL, with one…
A: The equation of dilution: C1 x V1 = C2 x V2 Where, C1 is the concentration of the stock solution. C2…
Q: Question 5 What would occur if the concentrations of GAP and GEF were reversed? (high [GEF] in…
A: Answer; imported cargo proteins would not be released in the nucleoplasm Explanation: If the…
Q: Glucagon facilitates the adaptation of our body to fasting. Which enzymes of glucides…
A: Glucagon is a pancreatic hormone secreted by the alpha cells of the pancreatic islets, composed of…
Q: How many total (NOT NET) molecules of ATP are synthesized from ADP via glycolysis of a single…
A: In glycolysis, a 6-carbon molecule of glucose-6-phosphate is broken down into 3-carbon pyruvate. It…
Q: What chemicals do you think are most harmful to your own health? How are you exposed? How could you…
A: Benzene and other aromatic hydrocarbons, along with heavy metal compounds are one of the the most if…
Q: The steroid progesterone has an important role in the female reproductive system. Researchers…
A: "Since you have asked multiple questions, we will solve the first three questions for you. If you…
Q: 1. If the hydrophobic solvent hexane (C6H14) was the "solvent of life", predict the following and…
A: The structure of biological macromolecules is determined by noncovalent interactions like…
Q: Passage 1 (Questions 1-4) Human immunodeficiency virus 1 (HIV-1) protease inhibitors have been…
A: Since you have posted multiple questions, we will provide the solutiononly to the first question as…
Q: (c) Outline how you would investigate whether BCMAP would be an effective inhibitor for the protein…
A: Inhibitors are the molecules that slow down or completely block the protein activity of molecules,…
Q: The aromatic side chain of Trp residues in proteins and peptides can be chemically modified by two…
A: Amino acids are classified as acidic, basic, hydrophobic and polar neutral based on the nature of…
Q: Give one example of a disease related to heart and briefly explain the molecular basis of the…
A: The human body, just like any other complex lifeform (or even simple lifeforms ) functions as a…
Q: TRUE OR FALSE 1. Rotational entropy is the freedom to move in three-dimensions. 2. Vitamin B1…
A: In the cellular environment, the condition do not allow biochemical reactions to occur at…
Q: IDENTIFICATION: 1.Complex organic compound w/c has the ability of speeding chemical reactions w/out…
A: Since you have posted multiple questions, we will provide the solution only to the first five…
Q: For the electrophoresis at 25°C of two proteins, in a medium with a viscosity of 0.001kg/m-s, the…
A: Electrophoresis is a technique used in biotechnology to separate and analyze biological molecules…
Q: Experimental results describing a protein's amino acid composition are useful for estimating the…
A: Proteins are high molecular weight polymers of amino acid residues linked together via peptide…
Q: .Here is an oligomeric protein, which has two binding sites: 1)Write the formulas of side chains of…
A: Oligomeric proteins are quaternary structure proteins which possess more than one subunit of…
Q: 2. Biosynthesis of cholesterol in the human body: 2.1. cellular and tissue localization of the…
A: Lipids are a chemically diverse group with two common characteristics: low solubility in water and…
- states the five functions of a globular protein and an example for each.
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- • Which division of the autonomic nervous system would likely be activated if a student learned that an exam they had forgotten about would start in 5 minutes? Explain. • Which one of the five categories of sensory receptors is primarily dedicated to external stimuli? • Explain what is happening here in muscle contraction. Be sure to tell me what role Ca+, ATP, myosin, and actin play. Thin filaments feee Binding of a new mol- ecule of ATP releases the myosin head from actin, and a new cycle begins. Thick filament Thin filament moves toward center of sarcomere. Myosin head (low- energy configuration) Releasing ADP and ℗. myosin returns to its low-energy configuration, sliding the thin filament Starting here, the myosin head is bound to ATP and is in its low-energy configuration. -Myosin head (low- energy configuration) Cross-bridge Thin filament Thick filament Actin The myosin head hydrolyzes ATP to ADP and inorganic phosphate () and is in its high-energy configuration. Myosin binding…3. [Essay] Do you know "IceBucket challenge"? The purpose of this public welfare activity is to help the patients with amyotrophic lateral sclerosis. The main symptom of amyotrophic lateral sclerosis is that the muscles of the patients gradually shrink until they die. However, not all muscles of the patients with amyotrophic lateral sclerosis are atrophic. Combined with the knowledge of muscle tissue we have learned, please talk about the types of muscle tissue, and what are the differences in the structure and function of these muscle tissues? What type of muscle atrophy in patients with amyotrophic lateral sclerosis?The muscular system is the one that receives the stimuli from the environment and executes a response. Select one: O True O False ort Jump to... I COLLADO ESPINAL (Log out) - (SP 2022- Prof. María Ruíz):
- Which of the following statements is false? Slow fibers have a small network of capillar ies. Slow fibers contain the pigment myoglobin. Slow fibers contain a large number of mitochondria. Slow fibers contract for extended periods.State the function of the following: Tropomyosin Troponin calmodulin electrocytes sonic muscles smooth muscle gap junctions cardiac muscle desmosomes smooth muscle agonist receptor Cardiac muscle dihydropyridine receptor Skeletal muscle dihydropyridine receptorDiscuss the following statement: “The basal lam-ina of muscle fibers serves as a molecular bulletin board,in which adjoining cells can post messages that direct thedifferentiation and function of the underlying cells.”
- hello sir Explain in detail about different local and systematic responses between biomaterial and tissues interactions???While the sarcoplasmic reticulum of muscle was first described by nineteenth-century microscopists, its true significance was not ap-preciated until its intricate structure was revealed much later by the electron microscope. What could you tell a nineteenth-century microscopist to enlighten him or her about the structure of the sarcoplasmic reticulum and its role in the coupling of excitation and contraction?Slow-twitch (type I/red) fibers have a distinctive feature: fatigue easily relatively low quantities of glycogen relatively low quantities of myoglobin show a fast response relatively low quantities of mitochondria
- classifications of carbs fibre give a summary of this classification:Skeletal muscle cell(key terms: striated, contracting proteins, contractions, nucleus location) One important structure/feature of a muscle cell isSelect ALL that could cause muscle cramping (a sustained muscle contraction) in skeletal muscle: OHyperexcitability of somatic motor neurons (secreting too much Ach) Botulism poisoning, which prevents Ach secretion from somatic motor neurons O Myasthenia Gravis, in which antibodies block Ach receptors at the motor end plate, preventing Ach from binding O Hypocalcemia, in which the calcium pumps of the sarcoplasmic reticulum are unable to keep Ca2+ inside the SR (allowing Ca2+ to leak into the cytoplasm)