Question 1 For import into the nucleus, proteins require: Ran-GTP active transport Pex5 an NES Question 2 The nuclear envelope contains nuclear pore complexes (NPCs) that allow small molecules to pass but excludes macromolecules larger than 40 kDa True False
Q: Relate sugar fermentation to the biochemical tests in bacterial identification
A: Glucose can be catabolized either aerobically (in the presence of O2), in which molecular oxygen…
Q: The key regulatory enzymes in glycolysis are: A) hexokinase, phosphofructokinase, and pyruvate…
A: In the anaerobic process of glycolysis, one glucose molecule is transformed into two pyruvate…
Q: The Krebs cycle reaction shown below is catalyzed by __ enzyme and ___ pays for this reaction note…
A: The TCA cycle or Kreb cycle occurs in the mitochondrial matrix. The TCA cycle uses the acetate in…
Q: 5. Explain in quantitative terms the circumstances under which the following reaction can proceed in…
A: Positive delta G means that the reaction cannot occur spontaneously. If delta G is negative then it…
Q: I'd like you to explain to me the structure of one of your macromolecules. You should be describing…
A: Bio molecules or biological molecules that are formed in the body of living organisms. These are…
Q: Tell why the citric acid cycle is obligately aerobic.
A: Glycolysis convert one 6-carbon molecule of glucose-6-phosphate into two molecules of 3-carbon…
Q: Differentiate reducing sugars from non-reducing sugars
A: Sugars are carbohydrates or saccharides. Sugars are ketone or aldehyde derivatives of straight-chain…
Q: FRET is a widely used biophysical technique for the characterization of a wide range of biomolecular…
A: FRET is a unique method for measuring the separation between a donor-acceptor pair of chromophores.…
Q: This is a catalase-positive, coagulase-negative, gram-positive coccus isolated from a urine specimen…
A: Introduction Bacteria are prokaryotic, unicellular organisms. They belong to the kingdom Monera.…
Q: 1. Explain the biochemical formation of creatinine, urea, and uric acid. 2. State the principle of…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: The lens of the eye si the light refracting medium of the eye, and ti has no mitochondria. Glucose…
A: "Since you have posted a question with multiple sub parts, we will provide the…
Q: DNA: AGA ACA TAA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GAC…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: Cow's milk allergy (CMA) and lactose intolerance both result from dietary exposure to cow's milk and…
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: The concentration of protein in a solution can be determined via UV spectroscopy and colorimetry*…
A: UV spectroscopy UV spectroscopy is a technique which uses the absorption of ultraviolet radiation by…
Q: 3. Consider the molecule dopamine (shown). Given that its pKa(NH3*) = 10.9. НО. a. What pH range…
A: A buffer system is a solution that contains an acid-conjugate base pair in equal proportions or…
Q: Explain the role of carnitine in the energy supply of the myocardium
A: Carnitine plays an important in heart's metabolism. It's responsible for transporting fatty acids,…
Q: Scope of Industrial biochemistry
A: Industrial biochemistry: The practice or application of set of chemical processes that occur within…
Q: Leu 93 Val 49. Are these two residues polar or hydrophobic (nonpolar)? What effect should their…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group attached to…
Q: 3. Please draw the core structure of Lignan, and numbering the C-atoms.
A: In 1948, Haworth first introduced the term "Lignan", which are also subgroup of non-flavonoid…
Q: 1. Describe how each of the following modes of analysis may be used to measure enzyme activity:…
A: Since you have posted multiple questions with multiple sub parts, we will provide the solution only…
Q: 1. Why is it necessary to calibrate a Pasteur pipette? 2. Cite some possible sources of errors in…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: For Gal(Beta 1 - 4)Glc, Explain in detail the glycoside bond: What carbon involved in glycoside…
A: The Structure of Gal(Beta 1-4)Glc is given below. 'Gal' stands for galactose and 'Glc' stands for…
Q: Choose the correct path taken by a pair of electrons as they travel down the electron-transport…
A: Electron transport chain consists of a group of protein complexes in the mitochondrial membrane…
Q: A. Dissolution of drugs Tablets Aspirin Bisacodyl Generalizations: Vinegar Solution pH: 2.5 5…
A: Dissociation of a weak acid is mathematically described by the Henderson-Hasselbalch equation: pH =…
Q: I am confused what is HDI. pls define in easy words.
A: Lipoproteins are triacylglycerols, phospholipids, cholesterol, and cholesterol esters associated…
Q: show how you would use bromination followed by amination to synthesize glycine show how you would…
A: Amino acids are building blocks of proteins. Alpha carbon of amino acids consist of carboxyl group,…
Q: True or false 1. Heterogenous antibodies used for structural studies can be obtained by monoclonal…
A: Heterogenous antibodies - Heterogenous terms indicates that the molecule is a hybrid. i.e. a single…
Q: Choose below the order of plasma lipoproteins based on the particle size (from smallest to largest):…
A: Lipoproteins are particles made of protein and lipids. They are responsible for carrying cholesterol…
Q: RUE OR FALSE 1. Abzymes reduce rotational entropy. 2. Hammerhead ribozymes have the ability to bind…
A: Enzymes are catalysts acting inside the living system to reduce the reaction time and speed up the…
Q: The processes that are involved in protein degradation and folding release energy in the form of ATP…
A: Protein degradation is the process in which proteins are hydrolysed and broken down into individual…
Q: 1. If the hydrophobic solvent hexane (C6H14) was the "solvent of life", predict the following and…
A: The structure of biological macromolecules is determined by noncovalent interactions like…
Q: Describe method by which uncoupling agents (like 2,4-dinitrophenol) inhibit oxidative…
A: The oxidation of carbohydrates such as glucose generates electrons that are carried to the electron…
Q: How DMT affects the brain?
A: Introduction Neurotransmitters are a type of chemical messengers that transmit chemical signals…
Q: what are the features which set the G protein family of receptors apart?
A: G protein-coupled receptors (GPCRs) are regarded as one of the most extensive families of validated…
Q: Is B monomer a beta fructose or alpha fructose. How do you know?
A: Cyclization of linear fructose can give us a furanose ring. Furanose is 5 membered ring . The 5…
Q: The folding of an unfolded protein proceeds from low entropy disordered state to a single high…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Why could the acrolein test be used as a general test for all fats?
A: The qualitative analysis of lipids assists us in determining the presence or absence of lipids based…
Q: How is osmosis different from simple diffusion? Oosmosis involves the movement of water, simple…
A: The two forms of passive transport that are essential for transporting molecules into and out of the…
Q: A. Given the following piece of messenger RNA (mRNA): CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAG…
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: 1. Which of the following statement is correct? a. Lipids can only participate in the TCA cycle. b.…
A: Metabolism of biomolecules is a interrelated process. The end product of one metabolic pathway can…
Q: I. ATP Calculation A. Given that three molecules of glucose underwent full oxidation, how many of…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: 2. The amino acid side chain residues in an a helix point center of the helix. A) Outward B) Inward…
A: Proteins have four level of structures. Primary structure Secondary Structure Tertiary Structure…
Q: Draw the L(leucine)-A(alanine)-E(glutamate) triple tide and calculate its isoelectric point.
A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…
Q: In protein structure, which is not established via secondary interactions? o tertiary o secondary o…
A: Proteins are polymers of amino acids linked by peptide/amide bond with release of one water molecule…
Q: 23. Which is a general term indicating a carbohydrate polymer? A) Glycan B) Polycarb C) Multimer D)…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: These enzymes form covalent intermediates A. Papain B. Alkaline phosphatase C. Elastase D. All of…
A: Enzymes are biological catalysts that increases the rate of the reaction. They do so by having a…
Q: Uracil and Adenine are two nitrogen bases constitutive of RNA. Both compounds show maximum…
A: The Beer Lamberts equation relates the absorbance value given by an analyte for a particular…
Q: b) How does oxygen availability determine the fate of the glycolysis pathway?
A: Glycolysis is a central metabolic pathway that is used by all cells for the oxidation of glucose for…
Q: How much 6x loading dye should be added to 49 uL of DNA? Report you answer in units of uL, with one…
A: The equation of dilution: M1xV1 = M2xV2 Where, M1 is the molar concentration of the stock solution.…
Q: Use dAMP and dTMP to draw the two monomers together
A: Nucleotides are structural components of nucleic acids (DNA or RNA). Nucleotides are composed of a…
Step by step
Solved in 3 steps
- Question 14 If the cell membrane is severley damaged, the cell will O use special proteins to plug any holes repair the damage make cholesterol and ergosterol to repair the damage O die O rapidly reproduceQuestion 1: A Small organic mdecule_containimg both an -NH2 group Oroup is čalled a Cm) [x]; t serves as the building block of proteins. and a - COOH Question 2: A [x] forms the structural basis of all cell membranes it is composed of a double layer of phas pholipid mokcules packed tegether in sheet. Buestion 3: A[x] can be a it has a general formula of lCH, 0)n Inoromer of complex corbohydrates and pely saccaridesQuestion 1 The ER occupies an extensive portion of the cytosol. Which compartment is physically connected to the ER? Golgi network Nucleus Mitochondria Lysosomes Question 5 Glycosv Mat, iully-f on impact protein fold ces Gistycosylated, so proteine ticking y Capelaria such as calner Ovosylation prevents wagine residues from interfe pation are markea e unfolded forming disulfide targeted by duse proteins to thereby assist folding
- QUESTION 12 Small nuclear RNAS (SNRNAS) regulate gene transcription O MRNA transport into the cytoplasm MRNA 3' cleavage MRNA translation and stability O splicing of mRNA precursorsQUESTION 12 All of the following statements are true about the nucleus EXCEPT Oa. It is surrounded by a nuclear envelope which is a single membrane. Ob. It contains the nucleolus where ribosomal subunits are made. Oc. The nuclear lamina maintains the shape of the nucleus. Od. In the nucleus, DNA combines with proteins to form chromatin. e. The nuclear envelop has pores and allows communication with the cytoplasm.Question 13 of 13 DNA A= 5' GGG GCT AGC CCC 3' DNA B= 3' ATA TAT ATA CCC 5' DNA C= 5' TAC GTT ACG TCG 3' DNA D= 3' ATC TTT GCA TTA 5' The DNA strand whose complementary RNA has the start codon for translation at the 3' end
- Question 32 Using the genetic code, indicate which polypeptides would be synthesized if poly-UGG were used in a synthetic RNA? NA 2nd potion U postion CAG Phe Ser Tyr Cys Phe Ser Tyr Cys U Leu Ser stop stop Leu Ser stop Trp Leu Pro His Arg Leu Pro His Arg Leu Pro Gin Arg Leu Pro Gin Arg lle Thr Asn Ser lle Thr Asn lle Thr Lys Arg Met Thr Lys Arg Val Ala Asp Gly Ala Asp Gly Val Ala Glu Gly Val Ala Glu Gly Amino Acids A) poly-V B) poly-G poly-W D) poly-Y O A G ၈၈၈၈»nt TheQuestion 14 Using the genetic code, indicate which polypeptides would be synthesized if poly-UGG were used in a synthetic RNA? RNA con 2nd poston UCAG powton pton Tyr Cys Tyr stop stop stop His His Gin Gln Phe Phe Leu Ser Ser Ser Cys A. Leu Leu Leu C Leu Leu Ser Pro Pro Pro Pro Trp G Аrg Arg C Arg A Arg lle lle lle Met Thr Thr Thr Thr Ser Asn Asn Lys Lys A Ser C. Arg A. Arg Gly Gly Glý Val G Val Val Ala Ala Ala Ala Asp Asp Glu Glu Val Gly G. Amino Acids Thearne w ve A) poly-W в) poly-G (c) poly-V D poly-YQUESTION 25 Proteins that lack a sorting signal remain as permanent residents of which part of a eukaryotic cell? OA. The Golgi OB. The lysosome OC. The endoplasmic reticulum OD. The cytoplasm O E. The nucleus QUESTION 26 How are integral membrane proteins thought to become integrated with a membrane? OA. They insert into the membrane at the same time as they are packaged into a COPII vesicle. OB. They insert into the membrane after translation is complete and the stop sequence is detected. OC. The are co-translationally imported into the ER by the translocon, which opens when it detects a stop transfer sequence to release the protein into the membrane. OD. They are implanted in the lipid bilayer by a flipase enzyme. QUESTION 27 Which cellular process does NOT occur in the smooth endoplasmic reticulum? OA. Calcium storage OB. Drug detoxification OC.O-linked glycosylation OD. Carbohydrate metabolism OE. Steroid biosynthesis
- Question 11 Given this MRNA strand: 3' - AUGAGGAAGGUA - 5'; what are the components of the polypeptide? First Position Third Position (3' end) (5' end) U A G UGU Cys UUU Phe UUC Phe UCU Ser UCC Ser UCA Ser UAU Tyr UAC Tyr UAA Stop UAG Stop |U UGC Cys UUA Leu UUG Leu UGA Stop |A UGG Trp U G CGU Arg CGC Arg CGA Arg UCG Ser CAU His САС His CAA Gln CAG Gln CUU Leu CCU Pro U ССС Pro CỤC Leu CỦA Leu CUG Leu CCA Pro A CCG Pro CGG Arg G U AAU Asn AAC Asn AAA Lys AAG Lys GAU Asp GAC Asp GAA Glu GAG Glu AUU Ile ACU Thr АСС Thr ACA Thr ACG Thr AGU Ser AUC Ile A AUA Ile AGC Ser AGA Arg A AUG Met* AGG Arg G GUU Val GGU Gly GCU Ala GCC Ala GCA Ala GCG Ala U GGC Gly GÚC Val G GUA Val GGA Gly |A GUG Val GGG Gly GQuestion 10 Synthesized proteins are processed either inside the organelles or in the cytoplasm O True False Question 11 Molecular chaperones interact with native proteins, and form part of the final folded structures True False Question 12 Which protein targeting pathway refers to the movement of polypeptides through the membrane as it is being synthesized? Post-translational O Post-transcriptional O Translocational O Co-translationalQuestion 17 What is the nucleotide sequence of the DNA strand that is complementary to 5'-ATCGCAACTGTCACTA-3 A 5'-UAGUGACAGUUGCGAU-3' B 5-TAGCGTTGACAGTGATA-3 5'-ATCACTGTCAACGCTA-3 D 5'-TAGTGACAGTTGCGAT-3'