Question 3A 50 kDa protein has a minimum radius 2.4nm, while a 20 kDa protein has a minimum radius of 1.78 nm. Based on this, which of thefollowing is likely true of the nuclear pore complex?mRNA (2 x 300 nm) would be able to pass freely through the porea protein with a radius of 1.5 nm would require a NLS for transport into the nucleusthe NPC would not allow proteins with a radius >2.5 nm to pass through freely, regardless of the protein's concentrationthe NPC allows proteins with a radius <1.78 nm to pass freely, and movement is dependent only on the protein's concentrationgradientHide Feedback for Question 3<10 KDa : passively controlled by concentration10-40 KDa : passive but regulated by calcium>40 kDa: requires active transport via importin/exportin Question 4If a cell had an over-expression of importin, it could result in increased import of proteins into the nucleus, but only if there was alsoa large enough supply of Ran-GTP in the nucleoplasm.TrueFalseHide Feedback for Question 4Ran-GTP is required for the cargo protein to be released in the nucleoplasm, and for importin to recycle back to the cytoplasm.

3 Answer the NPC would not allow proteins with a radius >2.5 nm to pass through freely,…

Answered: Question 3 A 50 kDa protein has a…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Practice question 1D) In the boxes on the image, label the N and C termini of the csRu protein. . Also on the schematic above, draw the csRH protein as you would find it at the plasma membrane. Be sure to label the N and C termini of the protein you draw to indicate its orientation. The csRu MRNA and protein are represented in the diagram below. mRNA 5' AUG 3' ribosome protein DNA ligand binding domain signal kinase transmembrane binding domain sequence domain domain cytoplasm plasma membrane extracellular fluid
Question 9 Why are integral membrane proteins difficult to study? O They are difficult to isolate in soluble form due to their hydrophobic transmembrane domains. They are difficult to isolate in soluble form due to their hydrophilic transmembrane domains. They are so small. They are so large.
QUESTION 7 UUUUU..3' Rho-independent (intrinsic) terminators in bacterial transcripts consist of a sequence that forms a "hairpin" stem-loop structure, followed in the direction of transcription by a polyuridine (polyU) sequence, as shown in the figure above. Which of the following template strand DNA sequences, when transcribed, will form a terminator structure in the transcript? 5 CCGACGTATCCGACGTTTTTTTT3' 5'AAAAAAAACCGACGTATCGTCGG3' 5 CCGACGTATCGTCGGAAAAAAAA3' 5 TTTTTTTTCCGACGTATCGTCGG3' 5 AAAAAAAACCGACGTATGCAGCC3'
QUESTION 27 What is meant by simultaneous translation transcription and why can this happen in prokaryotes but generally not eukaryotes? For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). BIUS Paragraph Arial 1 V 10pt = E V *** VE X² X₂ & ¶<
QUESTION 6 If the 3 proteins in the blue sample had MW's of [1] 87,000 Daltons, [2] 30,000 Daltons, [3] 15,000 Daltons; what is the MW of the protein in the 2nd band (counting from the origin) of the green sample? O O O O a. about 15,000 daltons b. about 87,000 daltons c. more than 30,000 daltons but less than 87,000 daltons d. about 30,000 daltons Cellular and Molecular Biology (6657
Question 7 A stretch of DNA that is comprised of 500 nucleotides is a O Gene O Codon O Anticodon Histone ?
QUESTION 49 What process copies a gene into RNA form? O a. Ribosomal RNA O b. Messenger RNA O C. Promoter O d. Transcription O e.Translation QUESTION 50 Which of the following membrane-crossing mechanisms requires energy? O a. Turgor O b. Active transport OC. Simple diffusion O d. Passive transport O e. Facilitated diffusion
Do question 6
Question 5 The initiation of protein synthesis or regulation of gene expression can be controlled by initiation factors that can be phosphorylated or dephosphorylated. (A) True B) False
Question 28 Introns Protein-coding sequences that need to be excised B Non-coding regions that need to be excised Protein-coding sequences that form part of the mature MRNA Non-coding regions that form part of the mature MRNA Question 29 Anomers are A Either the open chain structure or the cyclic structure, established through mutarotation B) Either L or D Cyclic monosaccharides that differ only in the positions of substituents at carbon (alpha or beta) The fifteen other stereoisomers of glucose Question 30 The nuclear lamina A is the site of ribosomal RNA (FRNA) synthesis maintains the shape of the nucleus encloses the nucleus to separate it from the cytoplasm D) regulates the entry and exit of molecules from the nucleus
Question 15 Which of the following types of RNA is most abundant in a typical cell? A messenger RNA B transfer RNA (c) ribosomal RNA D) small nuclear RNA
QUESTION 11 Which of the following statements about RNA interference pathways and mechanisms is FALSE? O A Investigators can load RISC and/or RITS complexes with artificial, designed RNAS in order to specifically target and silence a gene of interest as a way to see what the effect of that gene is when its expression is silenced. O B. Only a small section of a small interfering RNA, called the 'seed' sequence, is actually used to identify nucleic acid targets that are to be silenced. OC. Eukaryotic RNA interference pathways do not regulate genes from the genome itself (i.e. endogenous genes), they only respond to external infection events such as invading viruses. The piRNA pathway processes small RNAS out of long noncoding RNA transcripts and is important for suppression of repetitive element movement in germ cells. OD. O E. The micro (n RNA pathway and the short interfering (si) pathways load small RNAS into RISC or RITS complexes.

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS