1. 2. 3. Why does casein precipitates upon the addition of acetic acid? Why is milk used as an antidote in heavy metal poisoning? Can you identify which specific amino acid/functional group provides a positive result on the following tests? a. Biuret test b. Ninhydrin test c. Denaturation tests d. Xanthoproteic test
Q: Brown fat is a specialized form of fat that has high levels of mitocho contain uncoupling proteins.…
A: Brown adipose tissue is specialized in burning fat and is responsible for adaptive, non-shivering…
Q: Coenzyme Q (ubiquinone) can transport electrons between: OA) Complex I and Complex II. OB) Complex…
A: Coenzyme Q also known as Ubiquinone is an important component of electron transport chain. It is a…
Q: A. Dissolution of drugs Tablets Aspirin Bisacodyl Generalizations: Vinegar Solution pH: 2.5 5…
A: Dissociation of a weak acid is mathematically described by the Henderson-Hasselbalch equation: pH =…
Q: Assess the role of redox electron transfer in the formation of an electrochemical proton gradient…
A: All processes that would end up releasing energy will take place spontaneously. This energy released…
Q: what is main difference for B-DNA,A-DNA and Z-DNA
A: The two fundamental types of nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid…
Q: 1. 2. 3. Why does casein precipitates upon the addition of acetic acid? Why is milk used as an…
A: 1. Casein is stable in a solution, at pH values close to 7. This is because at this pH casein…
Q: Qualitative Tests for Carbohydrates: Sugar Solution Glucose Sucrose Lactose COLOR OBSERVED Molisch's…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: Which of the following is true of signal transduction mediated by protein tyrosine kinases…
A: Signal transduction is the process of transmission of chemical or physical signal intracellularly…
Q: Which of the following statements is NOT true of biological organic molecules? Their atoms are…
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: *While acetyl-SCOA activates pyruvate carboxylase, it inhibits pyruvate kinase. Explain how this is…
A: Complementary control is a type of metabolic regulation by which 2 complementary pathways are…
Q: Question 13 Which of the following is the correct order of the first sketch of amyloid cascade of…
A: Oxidative stress triggers an overproduction of amyloid precursor protein (APP) and transcription of…
Q: Which of these is not a suitable test for assessing folate status? red cell folate plasma…
A: Folate formerly known as folacin is a water soluble vitamin B or B9 usually found in some foods…
Q: The question stated the standard free energy change not the actual free energy change. You solved…
A: Standards free energy change calculated at biochemical standards is called biochemical standard free…
Q: 2. The amino acid side chain residues in an a helix point center of the helix. A) Outward B) Inward…
A: Proteins have four level of structures. Primary structure Secondary Structure Tertiary Structure…
Q: hich of the following statements concerning uncompetitive inhibitors is true? a. They decrease the…
A: Uncompetitive inhibition is also known as anti-competitive inhibition, takes place when an enzyme…
Q: At which temperature given does hemoglobin have a higher affinity for oxygen?
A: Hemoglobin is a protein that transports oxygen from lungs to tissues and CO2 from tissues to lungs.…
Q: Draw the potential tautomers of guanine. Based on Question 1c) (i), label the patterns of hydrogen…
A: Guanine is a nucleotide base found in nucleic acids like DNA and RNA . It pairs with Cytosine with…
Q: The location of enzymes is important for metabolic pathways. Which of the following enzymes is NOT…
A: Metabolic pathways require enzymes to catalyse their reactions. The pathways that occur in a…
Q: Which of the following is NOT a secondary database for structural classification of proteins?…
A: Proteins are polymers of amino acid that have five functional role. Protein databases are…
Q: Phosphatidate is: O A) a precursor to triacylglycerol synthesis. O B) a phospholipid. OC) indirectly…
A: Phosphatidates are ester phospholipids and belong to the category of phospholipids. Their structure…
Q: Which of the following substances is involved in de novo synthesis of purine nucleotides but not…
A: Metabolism is the sum total of all chemical transformations taking place within an organism. Most of…
Q: What are the health benefits of squash in a dessert recipe?
A: Squash is a comforting, delicious, and nutritious meal that is a mainstay throughout the autumn…
Q: Which of the following structures represent the same carbohydrate? CHO HO но- -Н EX Н -OH HOCH2 1…
A: Carbohydrates are polyhydroxy aldehydes or ketones. The general formula of carbohydrate is (CH2O)n.…
Q: Converting 1 mol of glucose to 2 mol of oxaloacetate will directly net __ ATP/GTP, __ NADH + H + ,…
A: In glycolysis, a 6-carbon molecule of glucose-6-phosphate is broken down into 3-carbon pyruvate. It…
Q: PLEASE HELP How many stereoisomers or ribose are there?
A: Stereoisomers are the isomeric molecular structures with same composition but with different…
Q: Cystic fibrosis is a recessive disease that affects many parts of the body, but primarily presents…
A: The CFTR gene codes for the protein cystic fibrosis transmembrane conductance regulator (CFTR). The…
Q: Which statement about glutamine amidotransferases is FALSE?
A: Glutamine amidotransferases is an enzyme which catalyzes the removal of ammonia group from glutamine…
Q: how you should dispose off sodium bicarbonate and does it have a signal
A: Introduction Hazardous waste is waste which has the potentiality to cause various health issues or…
Q: Enzymes increase the rate of a reaction by which contributing factor? - Increasing Keq -Formation…
A: Enzymes as biocatalysts catalyse the biochemical reactions by decreasing the activation energy so…
Q: Differentiate reducing sugars from non-reducing sugars
A: Sugars are carbohydrates or saccharides. Sugars are ketone or aldehyde derivatives of straight-chain…
Q: How much 6x loading dye should be added to 49 uL of DNA? Report you answer in units of uL, with one…
A: The equation of dilution: M1xV1 = M2xV2 Where, M1 is the molar concentration of the stock solution.…
Q: A. Given the following piece of messenger RNA (mRNA): CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAG…
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: Give an example of how signal transduction plays a role in disease
A: Introduction Signal transduction is a process which causes a series of molecular events in cells.…
Q: Enzyme A catalyzes the reaction S → P and has a KM of 50 μM and a Vmax of 100 nM s–1. Enzyme B…
A: The MM (Michaelis Menten) equation gives us the initial rate of a single substrate enzyme catalyzed…
Q: )picture1: what bond is this between cytosine and ribose? 2)picture2 : what bond is that bewteen…
A: Nucleotides are compounds made up of a nitrogen base, a sugar and a phosphate. The base can be…
Q: Give one example of a disease related to heart and briefly explain the molecular basis of the…
A: The human body, just like any other complex lifeform (or even simple lifeforms ) functions as a…
Q: Before myristic acid (14:0) can be oxidized to carbon dioxide and water, it must first:
A: Fatty acid catabolism involves beta oxidation followed by metabolism of the Acetyl CoA molecules…
Q: RC B H₂N-C- C A B H This content is protected and may not be shared, uploaded, or distributed. C A D…
A: Amino acids are the building blocks of protein. Structurally they contain compounds such as carbon,…
Q: TRUE OR FALSE 1. Rotational entropy is the freedom to move in three-dimensions. 2. Vitamin B1…
A: In the cellular environment, the condition do not allow biochemical reactions to occur at…
Q: a. Calculate the physiological DG of the reaction shown below at 37°C, as it occurs in the cytosol…
A: Since you have posted multiple questions, we will provide the solutiononly to the first question as…
Q: a) Draw the 5’-monophosphate-2’-deoxyguanosine nucleotide covalently bonded with neighboring DNA…
A: As per the Watson-Crick model of the DNA double helix: DNA is made up of two strands of…
Q: Given the following mRNA transcript: 5’-UUUGGCAUGGGUAUCGUAGAGAUGGAAUUCAUAGUGGAGUAA-3’ What is the…
A: The proteins are constituted of twenty naturally occurring amino acids. Each amino acid is encoded…
Q: Describe method by which uncoupling agents (like 2,4-dinitrophenol) inhibit oxidative…
A: The oxidation of carbohydrates such as glucose generates electrons that are carried to the electron…
Q: 3.(12pts) What is the ratio of NH4+/NH3 for a 0.5M solution of NH4Cl at pH 9? (The pKa of NH4+ is…
A: Dissociation of a weak acid is mathematically described by the Henderson-Hasselbalch equation: pH =…
Q: During phototransduction, the molecular processing in retinal rods under light activates mechanism…
A: Rods and cones are the two types of photoreceptors that are distributed in the retina. Rods are very…
Q: A TCL was run with 5 subjected samples utilizing a silica plate and ethanol/chloroform in mobile…
A: TLC (thin layer chromatography) is a type of partition chromatography, in which the samples are…
Q: give an example of how signal transduction plays a role in disease
A: Introduction: Our human body undergoes various processes to coordinate individual cells to support…
Q: a. In active muscle cells, the pO2 is about 10 torr at the cell surface and 1 torr at the…
A: Myoglobin and hemoglobin are oxygen storage and transport proteins. Myoglobin, whose primary…
Q: 1 Draw a general sketch ( backbone only ) of a protein alpha- helix and a beta shet.
A: Hi, thank you for the question. As per the honor code, we'll answer the first question since the…
Q: Meselson-Stahl Experiment showed that DNA replication is semi-conservative. In the experiment, DNA…
A: DNA replication is the biological process by which two identical replicas of DNA from one original…
Direction: Answer these thoroughly and explain. Thank you.
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- A. Explain why it is essential to digest all wild-type pQE. 1.-CRYGD. B. How would you make 50 mL o 1% weight per volume (w/v) agarose solution?MATCHING TYPE; Match A to B A. Acrolein tesT Benedicts test Biuret test Iodine test Barfoed’s test Molisch test Seliwanoff’s test Fehling’s test Salkowski’s test Furter-Meyer test B. A. The test for the presence of cholesterol. B. The test for reducing sugars in acidic solution. C. The test is used to detect cholesterol in a solution D. The test for the presence of starch/amylose. E. The test for presence of reducing sugars in alkali solution. F. The general test for carbohydrates. G. This method is used to detect the presence of tocopherols H. The test to distinguish monosaccharides from disaccharides I. The test for the presence of fats or glycerin. J. The test to determine ketohexose from an aldohexose.A. Detecting Dextrin in Starch 1. Iodine Test for Starch Describe any change that took place when Iodine was added. 2. Preparation of Dextrin from Starch a. Describe the color of starch while being heated. b. Describe the change upon the addition of Iodine. What color indicates the presence of dextrin? c. Compare the result obtained with Procedure 1. d. Describe the color change when Iodine was added to the solution of dextrin from the supply shelf. B. Reduction test for Sugars 1. FEHLING'S TEST SUGAR 1. Glucose 2. Sucrose 3. Maltose 4. Fructose 5. Lactose 6. Galactose 2. BENEDICTS TEST SUGAR 1. Glucose 2. Sucrose 3. Maltose 4. Fructose 5. Lactose 6. Galactose 3. BARFOED'S TEST SUGAR 1. Glucose 2. Sucrose 3. Maltose 4. Fructose 5. Lactose RESULT RESULT RESULT
- 1. The principle behind the test for phosphate is oxidative reaction, conversion of organic form to inorganic phosphate and a precipitation reaction. A. True B. False 2. Sakaguchi test determines amino acids with indole groups present. A. True B. False1. What is this lipid structure, give its role/ function, and enumerate its hydrolysis products or components. 2. Explain which hydrolyzed component will be positive in the Acrolein test? Ninhydrin test?19. The pH indicator in the carbohydrate metabolism test was a. methyl red b. eosin methylene blue c. neutral red d. phenol red e. bromthymol blue 20. Which of the following enzymes would be indicated by the sheep blood agar plate? a. catalase b. gelatinase c. citrate permase d. hemolysins e. lipase 21. The pH indicator in your EMB agar was plate. a. phenol red, selective b. methyl red, enrichment c. bromthymol blue, differential d. neutral red, selective e. eosin methylene blue, differential and it is an example of a inscloudgate.net/files/71e091b2-95...riXAGSX7kihG5XaOhFABsP7PBUexzlaVKNAmC
- &. How many milldiners of a 2wv Lidocaine HCI stock selution in water should be used in preparing 30 ml of a 0.5% wiv Lidocaine HCI solution? . From the following formula for antificial tears, caleulate the quantity of each ingrodient roquired to prepare half donen of the 0ml containers. Poyviny alcohol 149 Povidone Chiorobutanol Serile sodum chioride soution a.%. s to 100 m How many milldiners of water should be added to 60 ml. of a 2% wiv agqueous solution to prepare a 1% wiv solution?1. List down the amino acids in the following format Amino Acid Physiological Significance 3 letter Code 1 letter code Chemical Structure 2. List down the different qualitative and quantitative tests for Amino Acids Test Reagents Principle Positive Reaction/ResultB. COLOR REACTIONS. Give the ideal observation for the positive results of the following samples to complete the table below. Write NO RXN if the sample gives negative result for the given tests BIURET XANTHOPROTEIC NINHYDRIN SULFUR SAMPLES TEST TEST TEST TEST Formation of violet- Cysteine NO RXN colored product Formation of red- Tryptophan NO RXN colored solution Formation of Formation of violet- Keratin black colored product precipitate B - Alanine NO RXN NO RXN
- I. True or False ____________1] Mutarotation affects the reducing property ofcarbohydrates.____________2] Anthrone test can be use to test for the helicalconfiguration of a polysaccharide.____________3] Upon treatment with phenylhydrazine reagent & hydrolysis, maltose gives glucuronic acid and glucosazone.1. Provide the Principles and detailed procedures of the following tests for the "Color Reaction of Proteins". A. Biuret Test B. Xanthoproteic Test C. Millon's Test D. Ninhydrin Test E. Hopkins-Cole Test F. Sulfur Test G. Heller's Test2. What sample shows a positive result with the Molisch Test? Why did this sample give a positive result? 3. What is the chemical basis of the Xanthoproteic Test? 4. Egg white and milk are used as antidotes for heavy metal poisoning. Explain. 5. According to advertisements, commercial shampoo or conditioner contains “protein." Suggest a test that could be done on the product to check this claim? Explain your answer.