Release factors involved in translation supply a source of energy for termination of translation. bind to the stop codon in the A site of the ribosome, in place of a tRNA. release the ribosome from the ER to allow polypeptides into the cytosol. release the amino acid from its RNA to allow the amino acid to form a peptide bond. O000

Q: Which of the following step acts before the others in pro ribosome large subunits binds to mRNA TRNA…

A: The translation process completes in three main steps. they are initiation, elongation, and…

Q: How many of the same proteins are made at the same time by each ribosome in the translation of one…

A: since you have posted 2 questions. we will help you out with the first one only. the cells, a gene…

Q: The ribosome binds to the mRNA molecule to start translation of its code into a protein. What…

A: Step 1 The translation is the process in which the coded genetic message brought by mRNA (messenger…

Q: Describe the process of translation, focusing on the role of mRNA, ribosomes, ribosome-binding…

A: All the living cells are made up of protein, which act as building blocks for every organism. These…

Q: Explain the process of translation, including location, processes, and molecules involved

A: Replication, transcription, and translation are the basic process in the molecular dogma of the…

Q: Define transcription and translation. Give 3 ways in which they are similar and 3 ways in which they…

A: Central dogma of life is given by Francis crick in 1985.It gives an idea about flow of genetic…

Q: Explain how the translation and degradation of an mRNA may be controlled by RNA-binding proteins.

A: mRNA or messenger RNA (Ribonucleic acid) is bound by many RNA-binding proteins throughout its…

Q: The mRNA sequence AUG CAC AGU codes for the first three amino acids of a particular protein. Which…

A: The mRNA synthesized after transcription process undergoes translation to synthesize proteins. The…

Q: In a detailed diagram show and explain all the locations where RNA may regulate protein translation.…

A: A nucleic acid is a linear polymer of nucleotides that is a component of the cell's information…

Q: Which of the following statements concerning translation is NOT correct? O a. The first codon of…

A: Translation is the process of translating codons on mRNA into proteins. mRNA bind to ribosomes which…

Q: To begin translation, the small subunit of the ribosome starts moving down an mRNA.  What feature…

A: INTRODUCTION Translation  Translation is the process of conversion of mRNA into protein. It consist…

Q: What is the role of mRNA in protein biosynthesis process? Transfers amino acids to ribosome To bring…

A: Cells create proteins through a mechanism known as protein synthesis. Transcription and translation…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: In the role of the P-site and A-site what is: The Processes in the Central Dogma. Identify where…

A: Of course, let's delve into each aspect in more detail:1. Processes in the Central Dogma:  -…

Q: Explain where the energy comes from for the peptide bond formation during translation

A: The translation is the biochemical process of the synthesis of the polypeptide chain of amino acid…

Q: Translational termination occurs when the ribosome reaches a stop codon and the small ribosomal…

A: Translation termination occurs when the ribosome encounters a stop codon (UAG, UAA, or UGA). Thus…

Q: Describe translation. What is the function of the aminoacyl-tRNA synthase?

A: Protein synthesis: It is a process that involve peptide bond formation between the amino acids by…

Q: Which of the following is least likely following translation termination? The polypeptide is…

A: Introduction: Translation of termination is process in  which the genetic code is  within a…

Q: Match the post-translational protein modification to its function.   Creates new binding sites by…

A: Post translation modification of proteins are modification  reactions,which involves the addition of…

Q: Drag the functions involved in the bacterial translation process into the appropriate box with the…

A: IF1 Answer :  Prevents entry of an amino acyl trna into the ribosomeA site during the early initial…

Q: Describe the roles of mRNA, tRNA, and rRNA intranslating the genetic code.

A: During protein synthesis, translation is transforming the sequence of a messenger RNA (mRNA)…

Q: rovide SIGNIFICANT differences between prokaryotic and eukaryotic transcription and translation.…

A: Both transcription and translation is the method by which the genes express themselves this is also…

Q: Order the events of translational elongation. Follow the path of one TRNA through elongation. The…

A: Gene is the segment of DNA (deoxyribonucleic acid) that is responsible for heredity and inheritance…

Q: ic code helps for protein synthesis.

A: Ribosomes are known as minute particles which consist of RNA and  the associated proteins that…

Q: An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start…

A: Hereditary qualities are a piece of science stressed over the examination of qualities, hereditary…

Q: xplain the events of translation initiation, elongation and termination

A: The translation is the process in which information in the mRNA is converted into amino acids and…

Q: During protein synthesis, which step does NOT require energy? dissociation of the 70S ribosome after…

A: The process of gene expression involves two steps: transcription and translation. Translation is the…

Q: Draw/Diagram how translation starts at the N-terminus of a protein. Include the ribosome and label…

A: It is the process of the formation of proteins by the process of Translation. The proteins are…

Q: Briefly explain the two processes of transcription and translation and highlight the roles of the…

A: Transcription is a process in which RNA is synthesised with the help of template strand of DNA.…

Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…

A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.

Q: Describe the three stages of protein synthesis during translation

A: Introduction  Translation is the process by which genetic information in the form of messenger RNA…

Q: Which of the following is the first step of translation in a eukaryotic cell? a RNA containing…

A: Translation is the process of protein synthesis which is done by ribosomes.

Q: What distinguishes proteins that will be released into the cytoplasm after translation from proteins…

A: Protein synthesised in cytoplasm enters the endoplasmic reticulum via pores and is modified there.…

Q: Explain how mRNA plays a role in all three stages of translation.

A: Introduction: Central dogma is a two-step process and constitutes transcription and translation.…

Q: Contrast transcription and translation. Name at least three difference between the two processes

A: The process by which DNA forms mRNA is called transcription while the process by which mRNA forma…

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.