QUESTION 71 True or False: The sugar-phosphate groupings in DNA form the outside of the DNA double helix. True False

Q: The steady state level of a mRNA for a gene is affected by the following mechanism(s)

A: Messenger ribonucleic acid (mRNA) is a single-stranded RNA molecule that is linked to genetic…

Q: Question 5 The 2 chains composing one double helix run in opposite directions; they are antiparallel…

A: Introduction: The two types of nucleic acids are RNA and DNA. The nucleic acid functions as both a…

Q: Question 15 The process of amino acid activation A involves the formation of a peptide bond between…

A: Introduction Amino acids are molecules that combine to form proteins or the building blocks of…

Q: Question 8 Electrophoresis in agarose gel A The DNA will migrate to the negative elec- trode due to…

A: Agarose gel electrophoresis is a commonly used laboratory technique to separate the charged…

Q: Questión 13 Which of the following DNA parts actually refers to a six -membered heterocyclic ring? A…

A: DNA and RNA are macromolecules that make up nucleic acid. DNA (Deoxyribonucleic acid) is a genetic…

Q: A nucleoside consists of: а. Nitrogenous base, phosphate, 5 carbon sugar D: Nitrogenous base,…

A: Many nucleotides arranged in a linear chain through phosphodiester bonds are called nucleic acid…

Q: Question 8 Modification of histone proteins include the following EXCEPT A phosphorylation of serine…

A: Histones are highly basic proteins that compress DNA within the nucleus to produce chromatin, which…

Q: Question 38 The activated intermediate in the formation of the peptide bond is: O glucose O glucose…

A: A peptide bond, also known as a eupeptide bond, is a chemical connection made by combining the…

Q: The origins of replication on chromosomes are rich in a certain base-pairing. Which explanation…

A: Origin of replication:  The process of replication starts from specific sites on the DNA. These are…

Q: When determining the purity of DNA, it understood that pure DNA is identified by a ratio of between…

A: When isolating nucleic acids from a cell, the final product is a mixture of DNA, RNA and Proteins.…

Q: The 2 chains composing one double helix run in opposite directions; they are antiparallel (one is…

A: Nucleic acid is a biological macromolecules which is present inside the nucleus of the cell.  It…

Q: Very carefully analyze each nucleotide structures (base and sugars) and identify the structure(s)…

A: Deoxyribonucleic acid or DNA is a type of nucleic acid present in the nucleus of the cell. It is a…

Q: If the nonsense mutation is in the last exon of the mRNA, the result would be:

A: Exons are sections of an RNA transcript, that code for a protein. Exons are separated by non-coding…

Q: When comparing the mode of action of benzopyrene with ethidium bromide, one sees that both have a…

A: Gel electrophoresis is characterized as a technique that is utilized for the separation of DNA…

Q: 1x GGCGAUGGGCAAUAAACCGGGCCAGUAAGC Identify the start codon, and determine the complete amino acid…

A: Translation is the process of synthesis of proteins from mRNA. Proteins are synthesized by adding…

Q: QUESTION 13 You have isolated a nonsense mutation caused by a base substitution. This mutation is a…

A: Nonsense mutation: These mutations change a codon in a gene to one of the three termination codons…

Q: Question 22 Af the percentage of adenine in a given sample of DNA is 20%, then the ercentage of…

A: Chargaff's rule: He studied the base composition  of DNA on variety of sources and proposed the…

Q: There are leading strand and lagging strands in DNA replication. O True O False

A: DNA is a two stranded ladder like structure which act as template for formation of its own strand as…

Q: Question 36 DNA molecules can perform their function in replication and transcription as long as the…

A: Yes its a true statement . The hydrogen bonds between the bases of the DNA provides the…

Q: Each tRNA has unique identity elements recognized by its specific enzyme involved in charging it…

A: Proteins are polymers of amino acids that are linked by the peptide bond. Each amino acid in the…

Q: The Watson-Crick double helix is: O a. a. primary structure O b. tertiary structure O c. quaternary…

A: Nucleic acids are considered biomolecules that are very long threads of polymers. It is made up of a…

Q: Question 18 Replication origins have Repetitive lines; histone G-C rich; Helicase A-T rich; histone…

A: Introduction :- Histones are proteins that attach to DNA, form chromosomes, and regulate gene…

Q: True or False. Nonhomologous endjoining usually alters the DNA by deletions or insertions.

A: introduction :  Chromosomes that do not come from the same pair are referred to as non-homologous…

Q: Question 48 The energetic driving force for the synthesis of the new strand is the removal of the…

A: Removal of pyrophosphate group yields energy which is then diverted to the formation of new strands…

Q: The cyclic form of the sugar in DNA is a beta-D-3-deoxyribofuranose. (A) True B False

A: Q. The cyclic form of the sugar in DNA is a beta-D-3-deoxyribofuranose.  (A) True (B) False

Q: Which statement best explains why alcohols have a higher boiling point than Alcohols have weaker…

A: Alcohols are polar molecules and alkanes are non-polar molecules. Alcohols and alkanes both are…

Q: Question 14 Friedreich's ataxia is a rare inherited disease that causes nervous system damage and…

A: Tests that may help diagnose Friedreich's ataxia include nerve conduction studies, tests of heart…

Q: Question 52 All of the following describe the general mechanism of DNA synthesis EXCEPT: A synthesis…

A: DNA replication is the important step to protein synthesis. At the nucleoplasm of cell DNA…

Q: QUESTION 29 In samples of DNA, isolated from two unidentified species of bacteria X and Y, adenine…

A: According to Chargaff's rule that the amount of purine should be equal to pyrimidine and also that…

Q: The proteins and other substances that bind to the DNA rely mostly on non-covalent interaction to…

A: This statement is true. The proteins binds to DNA are of two types the histone and the non histone…

Q: For the DNA structure below write the correct base sequence in the form: 5-АТСТ-3 3'-TAGA-5 Make…

A: DNA or deoxyribonucleotide is the genetic material that is present in the higher organisms like…

Q: QUESTION 10 The drug shown in the figure below is an anticancer agent that disrupts the overall…

A: Cancer is defined as the abnormal unregulated division of the cells. Normal cells have a special…

Q: föllowing are characteristics of Transfer RNA except: O a. Only one loop has the codon that is…

A: d option

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.