Question 19 Listen . In Dragons, green skin and the ability to breath fire are on the same chromosome and are dominant to inability to breath fire and white skin You cross a dragon with green skin which can not breath fire to one with white skin that can breathe fire. You then take the offspring and breed them to dragons that can have white skin and can not breathe fire. You get the following results: 57 dragons have white skin and can breathe fire 51 dragons have green skin and cannot breathe fire 14 have green skin and can breathe fire 10 have white skin and cannot breathe fire How far apart are the genes? Round off your answer to the nearest whole number. Just give the number. Do not write "map units" or "percent" or any other words.

Q: QUESTION 6 The agouti gene in mice plays a role in determining coat colour. At this locus (a term…

A: The dominant recessive nature of two or more alleles of a gene decides the phenotypes. The genotypes…

Q: You are trying to separate five proteins, which are listed below, by gel filtration chromatography.…

A: Chromatography is a laboratory technique that helps to separate and identify components present in a…

Q: The steady state level of a mRNA for a gene is affected by the following mechanism(s)

A: Messenger ribonucleic acid (mRNA) is a single-stranded RNA molecule that is linked to genetic…

Q: Genetics Question 8

A: Gene 1:Ike's alleles: A, BBrenda's alleles: C, DJoe's alleles: A, CGene 2:Ike's alleles: X,…

Q: Question 13 Which regions (s) of the DNA are found in the final protein? Introns Exons UTRS poly-A…

A: Protein: Large biomolecules and macromolecules known as proteins are made up of one or more extended…

Q: Review translation. Which step is not a part of elongation cy O binding of small ribosomal unit to…

A: Translation : It is the process which involves formation of proteins from mRNA and ribosomes .  This…

Q: If the nonsense mutation is in the last exon of the mRNA, the result would be:

A: Exons are sections of an RNA transcript, that code for a protein. Exons are separated by non-coding…

Q: 1x GGCGAUGGGCAAUAAACCGGGCCAGUAAGC Identify the start codon, and determine the complete amino acid…

A: Translation is the process of synthesis of proteins from mRNA. Proteins are synthesized by adding…

Q: Genetics Question 9

A: The objective of the question is to determine whether a mutation in an enhancer that prevents the…

Q: Question 1 Listen You have the following DNA sequence: 5'GGT ACG TTG GGG CTC CAT3' This sequence is…

A: Transcription and translation are the fundamental processes by which cells interpret and utilize the…

Q: Question 50 Each strand of a homologous chromosome is called a: O Sister Chromatid O Chromatin O…

A: Chromatin - less condensed Chromosome - highly condensed Chromatin - Complex of DNA and proteins

Q: uestion 18 Recessive mutations in autosomal genes purple eye (pr), curved wing (c) and black body…

A: Genetic mapping:based on the calculation of recombination frequency.The concept of genetic mapping…

Q: Question 23 Sickle Cell Anemia Sickle cell anemia is a group of blood disorders that develop when a…

A: A series of genetic diseases collectively referred to as sickle cell disease includes sickle cell…

Q: QUESTION 10 Which one of the following is TRUE? A codon O is the basic unit of the genetic code…

A:

Q: The field of genetics that is interested in determining what the gene products (encoded by the…

A: Genomics is the study of whole genomes of organisms, and incorporates elements from genetics.…

Q: Produce the complimentary DNA strand that would be matched with the provided strand T--A C--G C --G…

A: A complementary strand of DNA is constructed based on base complementarity.  Complementarity is…

Q: QUESTION 40 If we had 6 different DNA/RNA nucleotide bases, strings of how many nucleotides would be…

A: Amino acids are the monomers for the formation of peptides or proteins having a chiral carbon with…

Q: DNA is chemically stable than RNA due to the on

A: DNA is a molecule made up of two polynucleotide chains that form a double helix and carry genetic…

Inheritance and Mendelian Genetics

Inheritance means the passing of traits to offspring from parents. These traits could be passed either through asexual reproduction or sexual reproduction. The offspring receives the genetic material from the parents. Mendelian inheritance is a certain biological inheritance that follows the rules and principles laid down by Gregor Mendel in 1865. The initial hypothesis was considered wrong, but other inheritance theories modified the concept of inheritance and thus genetics.