Q3. a) What are the choice of the pyrimidine bases in DNA and RNA? Explain the choice and reason of the different pyrimidine bases in DNA and RNA with structural representation.
Q: Draw the complete structure of uridine 5′-phosphate, one of the four major ribonucleotides.
A: Uridine monophosphate is used as a convenient delivery compound for uridine.
Q: 1- Biochemist Erwin Chargaff was the first to note that, in DNA, [A] = [T] and [G] = [C], equalities…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: A) Using this rule, determine the percentages of all the bases in DNA that is 20% thymine. [A] = [C]…
A: According to Chargaff's rule the percentage of Adenine [A] is equal to Thymine [T]. So if the given…
Q: Using Chargaff's rule, determine the percentages of all of the bases in DNA that is 26% thymine.
A: DNA stands for Deoxyribonucleic acid. It is the genetic material present in all living organisms. It…
Q: Q.)The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 109 In your answers,…
A: (A) No. Of base pairs in the bacterium continue Some important Data-- Molecular weight of one base…
Q: (i) Draw the structure of the RNA dinucleotide TG. (ii) What is the charge on this RNA dinucleotide…
A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for…
Q: Name and discuss using a representative example, the non-covalent interactions that maintains…
A: Introduction: The double-helical structure of DNA is made of two antiparallel strands running in the…
Q: Based on Chargaff’s rules, if a segment of DNA is composed of 20% adenine (A) bases, what is the…
A: DNA (Deoxyribonucleic acid) is the hereditary material present in most of the living organisms,…
Q: Discuss the reasons proteins were generally favored over DNA as the genetic material before 1940.…
A: DNA and RNA are considered as a genetic material. DNA is inherited or transferred from parents to…
Q: Describe the types of noncovalent interactions that stabilize DNA structure.
A: A non-covalent interaction differs from a covalent bond in that it does not involve the sharing of…
Q: 8a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…
A: Mutation can be defined as change in nucleotide sequence of a gene. Based on the type of change,…
Q: Name three parts of nucleotide 5. Name nitrogenous bases found in DNA and RNA 6. Discuss on the…
A: Since you have asked multiple questions, only the first three questions have been answered. Please…
Q: nucleic acid. b) . What is/are the major chemical difference(s) between RNA and DNA?
A: It is the question about nucleic acid i. DNA and RNA. Both DNA and RNA are nucleic acid but though…
Q: Explain the term FAD (flavin adenine dinucleotide) ? Define the importance of FAD (flavin adenine…
A: Answer- FAD or flavin adenine dinucleotide is a reduced energy equavalent and cofactors that play a…
Q: iven the structures of the nitrogenous bases below, draw the structure of a part of DNA with the…
A: The hereditary substance present in the cell is known as the genetic material. DNA acts as the…
Q: if the helix is more stable in water, would there be a way to synthetically create base pairs in…
A: Double stranded DNA is composed of two complementary strands with each strand consisting of sugar…
Q: What is the net charge of the peptide at pH 7 that is synthesized from this DNA sequence? 5'…
A: As we know that the DNA sequence exhibits codons, which helps in the formation of mRNA, and then…
Q: Does the design of the Hershey–Chase experiment distinguish between DNA and RNA as the molecule…
A: Introduction: Hershey and Chase performed an experiment on the bacteriophage having DNA and protein.…
Q: Describe the d=features of the following DNA-binding domains and how they interact with DNA.…
A: DNA-binding domain abbreviated as DBD is a protein domain that is folded independently and contains…
Q: AKS 5a: Which of the following combinations is true of the nucleotide composition of a sample of…
A: According to Chargaff's rule, DNA of organisms should have 1:1 stoichiometric ratio of pyrimidine…
Q: Which describe the similarities and differences in the composition of DNA and RNA? a.)In DNA Thymine…
A: 13 -correct option is - b.)In DNA Thymine paired with Adenine (T - A): In RNA Adenine paired with…
Q: If the amino acid sequences of monkeys and humans in the protein of two organisms are similar, why…
A: Amino acids Amino Acids are known as building blocks of proteins. There are many different kind of…
Q: 1. For this oligonucleotide, • dassify if RNA or DNA? Justify your choice. • determine the sequence…
A: Deoxy ribose nucleic acid or DNA has a Ribose sugar with deoxy hydroxyl group at 2'carbon. Ribose…
Q: Define the primary structure of DNA/RNA. Compare and contrast to the primary structure of proteins.
A: DNA/RNA are basically called as nucleic acid and it is important class of macromolecules which is…
Q: A. For each of the following nucleotide sequences, determine the amino acid sequence. 1. 5'…
A: Introduction Amino acids are molecules that combine to form proteins, They build muscles, prevents…
Q: Diagram the enol form of cytosine following a tautomeric shift. Include in the diagram how this…
A: The bases of nucleotides can undergo spontaneous structural alterations known as tautomerization;…
Q: What properties of DNA make it especially well suited to serve as the genetic material?
A: DNA is a type of nucleic acid. It is a polymer of nucleotide. Initially RNA is believed to be the…
Q: Which of the following statements is FALSE? Select one: a. G-C bonds are much more resistant to…
A: DNA and RNA show our genetic constitution.
Q: Explain how DNA-binding proteins can make sequence-specific contacts to a double-stranded DNA…
A: Introduction DNA is an organic chemical that contains genetic information as well as instructions…
Q: Describe the complementary, antiparallel, double-stranded structure of DNA.
A: DNA or Deoxyribonucleic acid is considered as the genetic material that contains all the hereditary…
Q: 30 A DNA sequence encoding a five-amino acid polypeptide is given below.…
A: The process of translating an mRNA strand into an amino acid sequence at the time of protein…
Q: Can you: describe the 2 D and 3 D structure of DNA including the bonding that takes place
A: DNA as genetic material in all the living organisms.
Q: How many hydrogen bonds are present in a DNA double helix fragment consisting of the following…
A: Deoxy ribonucleic acid is the double-stranded hereditary material that consists of sugar,…
Q: What are the four nitrogenous bases found in RNA? a) adenine, thymine, cytosine, guanine b)…
A: Nucleic acids are the essential macro molecules that carry and transmit genetic information in the…
Q: Which of the following rows describes the difference between DNA and RNA?
A: DNA or deoxyribonucleic acid is the double stranded helical structure that is the genetic material…
Q: 6. a.) Which part (sugar, phosphate, or nitrogenous base) of the four types of nucleotides differ?…
A: Nucleosides contain only sugar and a base whereas Nucleotides contain sugar, base, and a phosphate…
Q: Draw roughly the comparative electrophoretic mobilities of close circular DNA, open circular DNA and…
A: Electrophoresis is the common lab technique In which identification, quantification and purification…
Q: (1) Describe the nitrogenous base pairing in DNA and RNA. (2) Determine the number of bonds in each…
A: DNA and RNA are polynucleotides. Monomers of nucleic acids are nucleotides. Nucleotides are made up…
Q: 1. What is the purpose of hydrolyzing the RNA before conducting biochemical tests? 2. Enumerate…
A: Hi, thank you for posting the question on Bartleby. As per the guidelines, we can answer only one…
Q: What is the consensus sequence of these three DNA sequences? 5' - G G T G C A C - 3' 5' - A A T T C…
A: Gene is the primary unit of heredity of human life. It is found in the nucleus. It is transferable…
Q: 12. Identify the nucleotide from the following list of nucleic acid components. A. adenosine…
A: There are many biomolecules present in the human body. Some of the biomolecules are monomers that…
Q: Indicate whether each of the following base-pairing situations (1) involves two DNA strands, (2)…
A: Nucleotides are the monomers of nucleic acids, DNA and RNA. Each nucleotide is composed of a…
Q: How would the uniform 2 nm diameter of DNA be affected iftwo purines or two pyrimidines could pair…
A: DNA is called deoxyribonucleic acid. DNA is found in the genome of most of the organism. DNA stores…
Q: , Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAG TTA AGG CTC CTA GGT…
A: Note- According to the guidelines, we are supposed to solve first three subparts (a, b and c) of a…
Q: 30. Which of the following is FALSE when comparing RNA and DNA? A.are composed of nucleotides that…
A: Introduction :- Ribonucleic acid (RNA) is a DNA-like molecule. RNA, unlike DNA, is a single-stranded…
Step by step
Solved in 2 steps with 1 images
- (a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5' GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5' GTCCCATACGTAGCCGTAGGACATGTACCG 3' Y 5' CGGTACATGTCCTACGGCTACAATGCGATC 3' Z 5' TTACAGTGGACCTACGGCTACGTATGGGAC 3' I and 216. a.) Which part (sugar, phosphate, or nitrogenous base) of the four types of nucleotides differ? b.) Based on the complementary base pairing rules we know that: A(denosine) pairs with _________ , and that G(uanine) pairs with _________.2A Draw the complete structure of the trinucleotide 5'-A-G-C-3' (DNA).
- Explain the term FAD (flavin adenine dinucleotide) ? Define the importance of FAD (flavin adenine dinucleotide) ?1) a) Sketch an A-form helix and a B-form helix, highlighting the differences between them. Indicate the bases and backbone as lines. Label the major and minor grooves. 2) Sketch a ribose in the pucker that is expected in RNA. 3) Sketch a 2’ deoxyribose in the pucker that is expected in DNA. 4) Draw a GCG triplet (GC Watson-Crick), with perfect geometry. Draw the bases only, with dR’s at the N-9 positions of the purines (Gs) and at the N1 positions of the pyrimidine (C)a. Write the structural formula of GAC, a portion of DNA. Write the complementary strand adjacent to it so that the complementary bases are side by side. Connect the appropriate base pairs. b. Sticking to the convention of writing the nucleotide sequence in the 5'-3' direction, what is the nucleotide sequence of the DNA strand complementary to ATGCACCATGCT?
- 2. Of the two sequences, which is more likely to have helical structure. Explain. a) -Glu-Asp-Glu-Glu-Asp-Leu- b) -Glu-Leu-Asp-Arg-Val-Lys-a. Do any strands of nucleic acid exist in nature inwhich part of the strand is DNA and part is RNA?If so, describe when such strands of nucleic acidare synthesized. Is the RNA component at the 5′end or at the 3′ end?b. RNA primers in Okazaki fragments are usually veryshort, less than 10 nucleotides and sometimes asshort at 2 nucleotides in length. What does this facttell you about the processivity of the primaseenzyme—that is, the relative ability of the enzymeto continue polymerization as opposed to dissociatingfrom the template and from the molecule beingsynthesized? Which enzyme is likely to have a greaterprocessivity, primase or DNA polymerase III?List the pyrimidine bases, the purine bases, and the base-pairing rules for DNA.
- State the properties of the WatsonCrick model of DNA in the following categories: a. number of polynucleotide chains b. polarity (running in same direction or opposite directions) c. bases on interior or exterior of molecule d. sugar/phosphate on interior or exterior of molecule e. which bases pair with which f. right- or left-handed helixGiven the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions (with spaces), and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - CCTCGTTATGTG - 5' Mutated DNA Sequence: 3' - CCTCGTTATTTG - 5'For the trinucleotide 5’ G-C-A-3’ How many nucleotide subunits are present in its ‘backbone’? How many nucleotide ‘non-backbone’ subunits are present? How many phosphodiester linkages are present? What is the overall charge carried by the trinucleotide?