Provide the structure of the major organic product of reaction 1 and the major organic product after reaction 2 in the following reaction sequence (being sure to consider stereochemistry) CH3 1. SOCI,, pyridine HO. 2. NaCN

Q: Structures 1-3 are ___. Stabilized by hydrogen bonding The result of protein amino acid sequences…

A: This question is related to amino acid.   Structure 1 is an example of alpha helix. Structure 2 is…

Q: What are microelectrodes

A:

Q: After an electrophoresis experiment, how are the lengths of the DNA fragments in each lane…

A: In electrophoresis experiment is a technique to determine the size of DNA molecules on passing the…

Q: Agarose gel electrophoresis is relatively simple and straight forward to perform. Agarose is a…

A: two monomer units present in agarose are:

Q: Explain how a polyamide is able to bind to minor grooves and disrupt transcription.

A: Polyamide is a polymer in which a repeating unit is an amide group with a general chemical formula…

Q: Please enumerate and explain 1. WHAT ARE THE GENERAL RULES IN GRAMS STAINING CLASSIFICATION OF…

A: In microbiology, Gram staining is the most widely utilised, vital, and widely used differential…

Q: From a study of protein A as a function of temperature, we find that the ratio of unfolded protein…

A:

Q: Chemistry Q. compare normal maize and potato starch, which one gives a clear paste ? explain your…

A: Potato starch has the highest viscosity of any of the commercially available starches. It is a…

Q: Given

A: ✓1-Breadhave comparatively more gluten and cake have least among the three,so bread have highest…

Q: com X The folding of a protein is a complex and random process. Real Fake ê Abrir en Google…

A: A) Real    The folding of a protein is a complex and random process

Q: QUESTION 55 The likelihood that the longer elution times (Rf) were due to the following: O The more…

A: As per our guidelines, I can answer only first question. Because you have posted multiple questions.…

Q: The figure below shows TEM micrograph of a rubber toughened polystyrene (PS) orthotic (i.e. rubber…

A: Diffrential scanning calorimetry: Differential scanning calorimetry is a technique in which the…

Q: Define captopril ?

A: Captopril is a drug used to treat high blood pressure and congestive heart failure. Its IUPAC name…

Q: Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give…

A: In DNA sequencing, A compliments T whereas G compliments C ( Chargaff Rule). The formula for…

Q: the name for the three-dimensional VSEPR structure.

A: The given molecular structure is that of typical sp3d2 hybridised system, which gives a penta…

Q: Select the end products for digestion of starch. Check all that apply. Osucrase O galactose lactase…

A:

Q: Review View Help Enable Editing need to edit, it's safer to stay in Protected View. Question 7 MgBr…

A:

Q: QUESTION 19 Briefly explain why there are + and - charges in the amino acid structures in the table…

A:

Q: hich of the following statements is FALSE regarding linkage equilibrium & linkage disequilibrium?…

A: According to the question, we need to identify the false statements regarding linkage equilibrium…

Q: How much total fat, saturated fat and trans fat does this product contain per serving?

A: One serving equals 1 oz

Q: Draw the hydrogen bonds between A and T that hold the double helix together. Show both molecules and…

A:

Q: Part 1 Color the 3 main regions (Metals, Nonmetals, S Metalloids) a different color and label each…

A: Elements in periodic table can be either metals, non-metals, or metalloids.

Q: This structure indicated a peptide bond between alanine and threonine. Using a pen, draw a…

A: Step 1 - N-protection of n-terminal Amino acid (Alanine) Using tboc functionalityStep 2 -  C -…

Q: Q23: Dr. Alghe has just performed a restriction digest on DNA she extracted from her samples. She…

A: Given, we have 1.1% agarose gel which is mass/volume percentage  And the total volume of buffer is…

Q: % of KCIO3 in unkown

A: We have to find the % of KCIO3 in unkown

Q: Liquid X is known to have a lower viscosity and lower vapor pressure than Liquid Y. Use these facts…

A: Viscosity is a degree of a fluid's resistance to flow, whereas vapor pressure is a sign of a…

Q: For glucose, how many hydrogen bond acceptors are expected

A: The structure of glucose molecule is as shown below.

Q: I have a research project in Computational Chemistry Course entitled “Predicting binding of…

A: Carbohydrate-binding proteins will be proteins that can connect with sugar chains yet don't adjust…

Q: Consider Molecule X, which is found in all living cells. This molecule is transcribed from a stretch…

A: Based on the given information,molecule X is most probably referring to  the RNA.To be exact the…

Q: A reaction is carried out by mixing together a solution of K,CO, and a solution of Fe(NO,),. K,CO,…

A: Given : K2CO3 + Fe(NO3)2 --> FeCO3 + 2KNO3

Q: n one. Match enzyme or molecule with its function in bacteria. Answers may be used more than once or…

A: 37. RNA polymerase is the main enzyme in catalyzing DNA→ mRNA transcription.  38. DNA helicase…

Q: What is Natural Isolates * Explain * The process  * Example:

A: A natural isolate is naturally occurring chemical (single chemical) that is usually "isolated" from…

Q: Which protein folding interaction(s) is/are most likely to occur on the outside of a protein pocket…

A: Hydrophobic effects describe the energetic preference of non polar molecular surfaces interacting…

Q: what about the stereochemistry? Why aren't wedges/dashes used?

A: SN2 reactions : These reactions takes place in one step.Here ,the nucleophile attacks from…

Q: What is the quantity of GFP (µL) extract needed when provided with a 20 µL of 5X Laemmli sample…

A:

Q: QUESTION 18 Sample A is diluted by adding 50 uL to 950 ul of buffer to make solution B. Solution B…

A: The relation between the concentration of solution and absorbance is given by Beer Lambert's law.…

Q: Concentration Sof nicotinamide mono- nucleotide, in mM 0.138 0.220 0.291 0.560 0.766 1.460 a. 0.6482…

A: Here we are required to plot the Lineweaver Burk plot and find the VMax

Q: . Polyglycine, a simple polypeptide, can form a helix with 6 = -80°, ự = +150°. From the…

A: In Ramchandran Plot (φ) represent Phi (ψ) represent psi - Dihydral angle  - dihydral angle is the…

Q: What happens when a mixture of positively-charged Protein A and negatively-charged Protein B is…

A: Solution- Anion exchange column- In an anion exchange column, the packing is positively charged and…

Q: What name is given to the bond indicated in deoxyadenosine shown here? НО, OH A) amide bond B)…

A: Nucliotide is made up of nitrogenous base, pentose sugar and phosphate. Nucleoside is made up of…

Q: Draw the dipeptide that results when a peptide bond is formed between the two glycine molecules…

A: The structure is given below -

Q: ing strands OT nds of the in the ce

A: This question is related to bonding.

Q: What are emulsions? State one application of emulsification.

A: Emulsions are defined as the mixing of two or more liquids combine but the liquids combining are…

Q: fter an electrophoresis experiment, how are the lengths of the DNA fragments in each lane…

A: Introduction : Gel electrophoresis is a method used to separate DNA fragments .

Q: Past paper question

A: Key references:Alghoul, E., Basbous, J., & Constantinou, A. (2023). Compartmentalization of the…