Prions are Check All That Apply resistant to routine sterilization techniques. composed of protein, with no RNA or DNA. able to alter the configuration of normal proteins in nerve cells. responsible for several diseases, including measles and mumps. far larger than prokaryotic cells but smaller than most eukaryotic cells.

Prions are Check All That Apply resistant to routine sterilization techniques. composed of protein, with no RNA or DNA. able to alter the configuration of normal proteins in nerve cells. responsible for several diseases, including measles and mumps. far larger than prokaryotic cells but smaller than most eukaryotic cells.

Microbiology for Surgical Technologists (MindTap Course List)

2nd Edition

ISBN:9781111306663

Author:Margaret Rodriguez, Paul Price

Publisher:Margaret Rodriguez, Paul Price

Chapter1: Introduction To Microbiology

Section: Chapter Questions

Problem 1UTM: The Centers for Medicare and Medicaid Services (CMS) have initiated revised policies regarding...

See similar textbooks

Similar questions

of bacteria. The Gram stain works because of differences in the O 1) cell membranes O 2) genetic characteristics O 3) capsules O 4) antigens O 5) cell walls
Sterility: is achieved by most disinfectants and antiseptics (i.e., chemical agents) O is achieved by soap and water is the absence of PATHOGENS or spoilage-causing microbes ONLY Cannot be achieved by ethylene oxide O CANNOT be achieved by autoclaving O is the absence of ALL living cells and endospores
When microbiologists are working with bacterial batch cultures, we would expect to see no net change in bacterial numbers in ________________ , as this is the stage where the cells of the inoculum are adjusting to their new environment (i.e., the fresh culture medium) and preparing for cell division. stationary phase death phase lag phase log/exponential phase
The Centers for Medicare and Medicaid Services (CMS) have initiated revised policies regarding reimbursement to hospitals for care of patients who suffer health care-associated infections (HAIs) such as SSIs. Hospitals must bear the costs of treatment. Health care workers are the key in preventing patient injury and protecting hospitals. What is an example of a routine procedure performed by surgical technologists prior to entering the sterile field that would be part of the aseptic technique?
You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGT
Bonus: You are treating a patient with inhalation anthrax with antibiotics. After 2 weeks of antibiotics, the patient seems greatly improved and you discharge the patient. However in 1 week, the patient returns, obviously still suffering with inhalation anthrax. If the antibiotic you chose was based on antibiotic sensitivity tests, what would be the best explanation for the lack of treatment success? Bacillus anthracis_makes endospores which are resistant to all antibiotics O the outer membrane of the pathogen cell wall inhibited diffusion of the antibiotic into the cll O the antibioitc you chose could not cross the cell wall of the pathogen O the pathogen has a thick layer of peptidoglycan which prevent diffusion of the antibiotic into the cell Ouestion 10
Note that it is not appropriate to self-diagnose outside of a medical context and this is a completely hypothetical scenario. Imagine you have a rash on your foot. You're concerned that it's an infection and inoculate a sample onto an agar plate. You wonder, How can I figure out whether the pathogen is a bacterium vs a eukaryote? You decide to use lab supplies to get a basic understanding of the pathogen. Be specific about what tests you use and what you expect the results to be. Limit yourself to experiments we could do in our lab. What is one experiment you could do, involving culturing the organism?
Note that it is not appropriate to self-diagnose outside of a medical context and this is a completely hypothetical scenario. Imagine you have a rash on your foot. You're concerned that it's an infection and inoculate a sample onto an agar plate. You wonder, How can I figure out whether the pathogen is a bacterium vs a eukaryote? You decide to use lab supplies to get a basic understanding of the pathogen. Be specific about what tests you use and what you expect the results to be. Limit yourself to experiments we could do in our lab. What is a procedure you could do, involving making a slide of the organism?
Gold nanoparticles are applied in cancer therapy; approaches such as photothermal therapy as well as photothermal sensitization have been described. Which of the following statements is correct, mark all that apply: Photothermal therapy and sensitization are the same thing and the terms are used interchangeably Photothermal sensitization also leads to cancer cell death by heat but uses a more sensitive light source Photothermal therapy refers to the process of killing cancer cells by heat Photothermal sensitization weakens cancer cells and hence makes them more susceptible to other treatment regimens, e.g. chemotherapy
1. What is host resistance in bacteria? 2. What is gram staining technique? 3. Difference between lysosomes and peroxisomes. 4. What are microtubules in cell? 5. Define endoplasmic reticulum, mitochondria, cytoskeleton, ribosomes, vesicles, golgi apparatus, chloroplasts, vacuole, pili and fimbriae, transcription, plasma membrane, cytoplasm, DNA 6. Meaning of primitive cells.
Use the following statements that best describes the antibiotic mechanism for each: Statement: Targets cell wall synthesis Targets protein synthesis Targets nucleic acid synthesis Targets cell membrane Inhibits folic acid synthesis (metabolism inhibitor) Pseudomaona aeroguinosa Plate Antibiotic Amoxicillin Cephalothin Chloramphenicol Ciprofloxicin Clindamycin Erythromycin Oxacillin Penicillin G S. aureus Other Streptomycin Tetracycline Tobramycin Trimethoprim sulfa
what is plaque essay? what is the purpose of this lab? why this lab is perform? (bacteriophage) what techniques is used and how can we derive information(data)? methologies, theory, mechanism for reactions that lead to observable results. required information on microbial metabolism. why is the microbe doing this?