point mutations that affect the amino acid sequence of a protein include, frameshift mutations, nosense mutations, and missence mutations.  In some cases the changed amino acid has no affect on the funtion of the protein, other times the changed amino acid can have a significant deleterious effects.  Choose one  of the types of point  mutations described above to explain when a change in amino acid has a negative effect on protein function and when a change has no noticable effect on protein function.

Q: Some types of tumors express cell-surface receptors that are specific for unique peptide sequences.…

A: Of these 9 amino acids, 7 amino acids(H,W,S,Y,L,P,G) will be carrying a positive charge at pH 4. At…

Q: Most mutations are harmful or neutral, although in rare instances some can be beneficial where hey…

A: TRUE

Q: Briefly (list in bullet points) what are the FIVE stages of Protein synthesis. Why do you suppose…

A:

Q: You suspect a protein that is being expressed has been affected by a mutation.  When you examine the…

A: mutations in the DNA sequences is of many type and can effect the sequence of transcribed mRNA and…

Q: 6. Celiac disease is a disorder of the small intestine characterized by autoimmune response to…

A: Gluten protein is commonly found in many cereals like Wheat, barley, rye etc and is difficult to…

Q: Post-translational modification of proteins refers to the covalent and  enzymatic modification of…

A: The translation is a process by which the proteins are synthesized from the RNA. RNA polymerase and…

Q: If a gene for a polypeptide has a mutation that causes an amino acid change but the new amino acid…

A: Mutation is molecular change in the DNA sequence of a gene. Mutations in the coding sequence of a…

Q: A mutation occurred that changes the sequence of DNA from: 5’ACGTCATGGATAGTGCGTAAACTA3’ to…

A: Mutations are abrupt changes in DNA only one ways has been changed the original DNA.

Q: Which of the following mutations in a gene will most likely have the greatest impact on the…

A: Mutation is any change in structures or functional aspects of gene (genome ) which may occur due to…

Q: Two possible point mutations are the substitution of lysine for leucine or the substitution of…

A: Amino acid mutations refer to changes in the DNA sequence that result in alterations to the sequence…

Q: Some mutations affect changes in protein structure and function that can result in disease whereas…

A: The DNA (deoxyribonucleic acid) is the genetic material of an organism. The DNA is inherited by the…

Q: An addition or deletion mutation that results in all of the amino acids after the mutation being…

A: A mutation refers to the sudden change in DNA (deoxyribonucleic acid) that subsequently affects the…

Q: suppose that a gene has a mutation that changes one nucleotide. Because of this one nucleotide…

A: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to external…

Q: Some substitution mutation result in a malfunctioning protein but others do not. Why is this? 

A: Introduction : A mutation is a change that occurs during the copying or replication of DNA…

Q: Which of the following terms refer to the case when a mutation results in a significant decrease or…

A: The chenge in DNA sequence of an organisms is known as mutation.

Q: Use the description of the FGFR3 and your knowledge of protein synthesis to explain how this…

A: FGFR3 stands for fibroblast growth factor receptor 3. It is found in the cell's membrane and sense…

Q: A mutation that changes an alanine to a leucine in the nucleus of a protein leads to a less active…

A: Introduction: Each organism's DNA sequence is unique. Its base-pairs sequence can change from time…

Q: How would tissue(ECM)be affected by the following mutation: Collagen(GXP50) mutation, where 50…

A: Extracellular matrix(ECM): Extracellular matrix is a complex network of collagen fibers found just…

Q: Discuss how mutations impact protein function. Namely hypothesis the affect these particular…

A: Mutations, variations in a gene's DNA sequence, occur in nature spontaneously. Since alleles are…

Q: A point mutation occurs in the middle of the coding sequence for agene. Which types of…

A: Mutation is the process of abrupt changes in the nucleotide sequence or gene in the DNA. Mutation…

Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…

A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.

Q: Which of the following is not true?   There are two major classes of aminoacyl-tRNA synthetases…

A: Central dogma includes three main processes Replication, Transcription, and Translation.…

Q: A normal polypeptide and a mutant of the polypeptide were hydrolyzed by an endopeptidase under the…

A: Chromatography is a useful technique to study the separation of amino acids. Paper chromatography is…

Q: name one kind of mutation that produces an altered protein. what determines wether the altered…

A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…

Q: The sequences (N-terminal to C-terminal) of the smaller peptides produced by trypsin digestion were…

A: Enzymes can catalyze several reactions and aid in speeding up a reaction. There are several enzymes…

Q: Describe the effect of the substitution mutation in a sequence of amino acids.

A: Mutation is defined as a change in the sequence of DNA that occurs as a result of DNA copying errors…

Q: The following sequence is a portion of the N-terminus of the ACE2 receptor.  The secondary structure…

A: Each amino acid has a different property.

Q: Sickle-cell disease is caused by a so-called point mutation in the humanβ-globin gene. A point…

A: Two b-globin polypeptides combine with two a-globin polypeptides (encoded by another gene family)…

Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…

A: The genetic code is a set of three-letter combinations of nucleotides called codons, each of which…

Q: Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which…

A: CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator…

Q: If the first G changes to A what kind of mutation will happen? Show the change in amino acid…

A: When there is an error in the DNA sequence during replication it causes a change in the DNA…

Q: HbS results from the substitution of valine forglutamic acid at the number 6 position in the b…

A: HbS is the result of a single base-pair mutation in the gene responsible for the beta-globin chain…

Q: Changing only the R-group on a penicillin-family antibiotic could have many consequences. Which of…

A: Penicillin (PCN) belongs to a group of antibiotics used to treat a huge range of bacterial…

Q: Describe the effect of this mutation on the amino acid sequence of the beta-gloving polypeptide…

A: Point mutation It refers to the mutation in which the single-nucleotide of the sequence of DNA…

Q: A polypeptide is cleaved into peptides by treatment with trypsin and cyanogen bromide, and then the…

A: Trypsin cleaves specifically peptide bonds at the C-terminal side of lysine (K) and arginine (R)…

Q: Galactosemia is a metabolic disorder characterized by the inability to metabolize the sugar…

A: Galactosemia It is a rare genetic metabolic disorder that affects how the body processes a simple…

Q: Describe the effect of the substitution mutation in a sequence of amino acids.

A: Mutation can be outlined as the change within a DNA sequence and it basically results from the…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.