Name: Date: Entry #: PROTEIN SYNTHESIS PRACTICE Protein synthesis is a complex process. In this activity, you will trace the steps that are involved in the protein synthesis of a part of an oxytocin molecule. Oxytocin is a pituitary gland (brain) hormone that helps regulate blood pressure, stimulates the uterus to contract during childbirth and stimulates the production of milk after childbirth. 1) Protein synthesis begins with DNA in the nucleus. Below is a DNA sequence that codes for part of an oxytocin molecule. Write the sequence of messenger RNA (MRNA) codons that would result from the transcription of this portion of DNA. The arrow marks the starting point. DNA АСА TTG АCG GGG AAC CC 9 ATA ATT TAG 3 CTT 2 4. 7 10 MRNA

Q: c) Give an account of how messenger RNA (mRNA) is produced in the cell nucleus (transcription) and…

A: Hoe mRNA is produced in cell nucleus : in molecular biology messenger RNA ( ribonucleic acid  ) is a…

Q: Summarize the data below obtained from the protein experiments for determination of protein…

A: The principle of the Bradford assay is based on the fact that the absorbance maximum for an acidic…

Q: Questions 19-24: Gene structure/Splicing problem. “Protein X" consists of a total of 431 amino…

A: In a DNA sequence, Intron is the non coding portion and exon is the coding portion. After splicing…

Q: TRANSLATION: Antibiotics are drugs that are bacteriostatic or bactericidal. Both antibiotic types…

A: Antibiotics are broadly classified as bacteriostatic and bactericidal. Bacteriostatic: These…

Q: 1Need help:. draw valine-aminoacyl tRNA synthetase. Show the tRNAs and the valine amino acid. You…

A: A transfer RNA (tRNA) is a unique type of RNA molecule with the essential function of facilitating…

Q: the same Protein X was purified from tissue source A and tissue source B, yielding the following…

A: Introduction  Proteins are large biomolecules that play critical roles in almost all cellular…

Q: Situational task: As a result of intoxication, enzymes that provide splicing are not synthesized in…

A: Introduction :- Splicing is the process by which introns (non-coding regions) are removed from a…

Q: ACTIVITY 3. POINT MUTATION Directions: Translate the genes in the TRNA into amino acids. Then,…

A: Introduction  Genome consists of DNA/RNA which consists of nucleotides either deoxyribose…

Q: Which of the following statements about eukaryotic RNA is true? O Exons are spliced together. OA…

A: Exons are spliced together True - Splicing is defined as a process in which the introbs , the non…

Q: Describe instances when a DNA mutation would not alter the function of a protein. Describe instances…

A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…

Q: How much of a 10 mg/ml DNase stock would you need to add to 4 mL of cells for a final concentration…

A: DNA  ( deoxyribonucleic acid ) is a two stranded helical structure that functions as genetic…

Q: - COMPLETION: Complete the table below, supply the oiven DNA template to its co correct codon and…

A: Introduction:

Q: DNA sense or template DNA sense or template mRNA tRNA protein 5', 3' amino or carboxyl 5' T U A A RG…

A: The genetic information for protein synthesis is stored in DNA. DNA is double-stranded. The…

Q: Briefly describe the differences in the transcription and translation processes as they occur in…

A: Asked : Difference in transcription, translation in prokaryotes, eukaryotes

Q: AKS 5c1: Which of the following models BEST represents protein synthesis? * O MRNA (UAC AAA) DNA…

A: Gene expression is the process of three consecutive steps namely replication, transcription, and…

Q: In denaturation of DNA and protein explain how denaturation brings about the ailment and what its…

A: Protein Denaturation:                     A cell death is symbolized by the advent consequence of…

Q: disease that results from either protein misfolding or protein misregulation, name of the disorder,…

A: Protein misfolding can occur due to many reasons which include -  genetic mutations, translational…

Q: 2. C S 1. Te

A: 1) The phenomenon of complementary base pairing occurs when guanine always hydrogen bonds to…

Q: The process by which base pairs combine with each other to form a strand of DNA is called _______.…

A: DNA is composed of four types of nucleotide, adenine, guanine, thymine and cytosine. Adenine pair…

Q: Problam4: Write the name of atleast 2 protein separation technique and explain any one of them…

A: Following are the methods of proteins separation:-  1. Ultracentrifugation 2. Salt fractionation 3.…

Q: DNA RNA PROTEIN

A: The central dogma is a molecular biology process that converts DNA to RNA and creates a functioning…

Q: TRUE OR FALSE 1. The RNA molecules could be found in the nucleoplasm 2. The cyclobutane pyrimidine…

A: There are two types of nucleic acids : DNA : Deoxyribonucleic acid RNA : Ribonucleic acid  DNA and…

Q: Discuss about serines/threonines

A: An enzyme that catalyzes the phosphorylation reaction is called “kinase”. This enzyme transfers a…

Q: Please answer this quickly

A: The cells are of two types - prokaryotes and eukaryotes. Prokaryotes are primitive cells without any…

Q: Questions 19-22: Based on the information presented above (and relevant info from your textbook,…

A: Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…

Q: Check the box under each molecule for which the statement in the first column is true. statement It…

A: The question asks to identify the molecule for which a given statement is true out of three options…

Q: GTTTTCACTGGCGAGCGTCATCTTCCTACT 5. Calculate molecular weight (kiloDalton, kD) and calculated pI…

A: Hi! Thanks for your question. As you have posted multiple questions, we are answering the first two…

Q: 1. DNA Sequence: TẠC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCG GCT CTC CCA GTT GAA CT…

A: As per our guidelines, we are supposed to answer only one question. Please repost other question in…

Q: Some scientists have concluded that this method of gene therapy will be a more effective long-term…

A: Hematopoietic stem cell transplantation (HSCT) involves the intravenous (IV) infusion of autologous…

Q: Children with developmental dyscalculia have difficulties with

A: Dyscalculia is a type of disorder in which an affected individual is unable to any number-based…

Q: You have cloned the gene for a human erythrocyte protein, which you suspect is a membrane protein.…

A: A hydropathy plot is a tool used to visualize the hydrophobicity or hydrophilicity of a protein…

Q: Identify the polar and nonpolar parts of the assembly. Identify the pocket and the two bilayers that…

A: Polar components are those that are hydrophilic and soluble in water. Non polar components are those…

Q: codon table st ition A U Phe Ser Tyr Phe Ser Tyr Leu Ser stop Leu Ser stop Leu C Leu Leu Leu Pro His…

A: In the sequence fill ups we can see that few sequences are given in DNA, mRNA,  tRNA and  amino…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: 5’ GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG 3'  From above sequence…

Q: List all the cellular components (organelles and structures) involved in the proteins production.…

A: The study of the formation, functioning, and behavior of cells is known as cell biology. Cells are…

Q: Make up a DNA sequence of at least 18 nucleotides and then (2) show the mRNA sequence that will be…

A: mRNA  A sequence of ribonucleic acid bases that is made up from DNA by the process of transcription.

Q: Assessment Criteria 2.2: Describe and explain protein synthesis Answer the following questions:…

A: Gene expression is the process by which the information stored in a gene is used to synthesize a…

Q: C. Deepen (Pagpapalalim ng Kaalaman) Let us do the activity below. (50 mins. with provision for…

A: Transcription is the process of synthesis of mRNA from DNA. And the process of synthesis of protein…

Q: Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of…

A: The replication, transcription and translation are the very important processes in cell biology that…

Q: What is the first step in protein synthesis? A. making an RNA copy of the DNA within the nucleus

A: In eukaryotes, they are made of DNA and a membrane-bound nucleus. The eukaryotes make their own…

Q: is DNA replication and Polymerase Chain Reaction the same process? Substantiate your answer in terms…

A: Introduction DNA replication is the biological process of making two identical copies of DNA from…

Q: INSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS…

A: DNA is also called deoxyribonucleic acid. DNA act as the genetic material in most organisms. RNA is…

Q: Task 2: Review the process of protein synthesis by placing the cards in their appropriate category.

A: The protein synthesis is the anabolic process of the synthesis of the protein by the polymerization…

Q: Drug 2-Lumacaftor (VX-809): In people with the most common CF mutation, F508del, a series of…

A: This mutation occurs in the gene cystic fibrosis transmembrane conductance regulator (CFTR).

Q: Assignment 9: Transcribing and Translating a Protein Activity  5.4.1 Synthesis of a Protein: A…

A: 1. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence…

Q: Question 1: Answer all practice question parts Label the leading and lagging strands below: 3' Label…

A: DNA is a genetic molecule which undergoes replication and is required for protein synthesis.

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.