Name: Date: Entry #: PROTEIN SYNTHESIS PRACTICE Protein synthesis is a complex process. In this activity, you will trace the steps that are involved in the protein synthesis of a part of an oxytocin molecule. Oxytocin is a pituitary gland (brain) hormone that helps regulate blood pressure, stimulates the uterus to contract during childbirth and stimulates the production of milk after childbirth. 1) Protein synthesis begins with DNA in the nucleus. Below is a DNA sequence that codes for part of an oxytocin molecule. Write the sequence of messenger RNA (MRNA) codons that would result from the transcription of this portion of DNA. The arrow marks the starting point. DNA АСА TTG АCG GGG AAC CC 9 ATA ATT TAG 3 CTT 2 4. 7 10 MRNA

Q: You are working on a lab activity, and raise the temperature of the enzyme in the experiment. You…

A: enzymes are protein molecules which helps in catalyzing biological reactions . they are usually…

Q: Questions 19-24: Gene structure/Splicing problem. “Protein X" consists of a total of 431 amino…

A: In a DNA sequence, Intron is the non coding portion and exon is the coding portion. After splicing…

Q: protein that charges its conformation ( and often its activity) when it binds a regulatory molecule…

A: Answer -  Ligase -  The RNA primer is responsible for initiation of DNA synthesis are removed by…

Q: 1. T DNA strand NUCLEUS MRNA CU CYTOPLASM 6. 5. Lysine 7. AAGUUU UGUUCA AA 4. 2.

A: CENTRAL DOGMA-  Replication is the process when DNA replicates itself means it will make copies of…

Q: Describe instances when a DNA mutation would not alter the function of a protein. Describe instances…

A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…

Q: b. How is the DNA information used to make proteins for ongoing cellular processes and cellular…

A: Introduction DNA is the molecular structure that is composed of a pair of polynucleotide chains and…

Q: True/ False: you are asked to determine if the statement is TRUE or FALSE. You must write out the wo…

A: Separating macromolecules such as DNA, RNA, and proteins are done using gel electrophoresis.

Q: 7. Human proteins can be produced in a variety of organisms. What would be advantages of producing…

A: Biotechnology can be defined as the practice of using living organisms such as animals, plants,…

Q: AKS 5c1: Which of the following models BEST represents protein synthesis? * O MRNA (UAC AAA) DNA…

A: Gene expression is the process of three consecutive steps namely replication, transcription, and…

Q: disease that results from either protein misfolding or protein misregulation, name of the disorder,…

A: Protein misfolding can occur due to many reasons which include -  genetic mutations, translational…

Q: The process by which base pairs combine with each other to form a strand of DNA is called _______.…

A: DNA is composed of four types of nucleotide, adenine, guanine, thymine and cytosine. Adenine pair…

Q: Lab 7: Protein Synthesis B. The DNA code for the A chain of insulin Below is the DNA base sequence…

A: Introduction  The process through which a gene's information is used to produce either RNA molecules…

Q: True or false?: The CTD is responsible for mRNA-processing steps that are specific for mRNA and not…

A: BASIC INFORMATION TRANSCRIPTION  It is responsible for the formation of hnRNA which has the codes…

Q: Use the description of the FGFR3 and your knowledge of protein synthesis to explain how this…

A: FGFR3 stands for fibroblast growth factor receptor 3. It is found in the cell's membrane and sense…

Q: GTTTTCACTGGCGAGCGTCATCTTCCTACT 5. Calculate molecular weight (kiloDalton, kD) and calculated pI…

A: Hi! Thanks for your question. As you have posted multiple questions, we are answering the first two…

Q: Please help me with this question. More than one answer may be correct.  The rough endoplasmic…

A: The endoplasmic reticulum performs numerous other crucial tasks, including folding proteins, but it…

Q: You have cloned the gene for a human erythrocyte protein, which you suspect is a membrane protein.…

A: A hydropathy plot is a tool used to visualize the hydrophobicity or hydrophilicity of a protein…

Q: Need help Below is a strand of mRNA with three codons listed on the strand. Imagine the mRNA strand…

A: Translation is a process of reading of mRNA to form proteins. It requires several components ljke…

Q: codon table st ition A U Phe Ser Tyr Phe Ser Tyr Leu Ser stop Leu Ser stop Leu C Leu Leu Leu Pro His…

A: In the sequence fill ups we can see that few sequences are given in DNA, mRNA,  tRNA and  amino…

Q: ATP and GTP play a few roles during transcription and translation. What are two roles that ATP plays…

A: ATP and GTP have different roles during Transcription and translation.

Q: Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of…

A: The replication, transcription and translation are the very important processes in cell biology that…

Q: What is the first step in protein synthesis? A. making an RNA copy of the DNA within the nucleus

A: In eukaryotes, they are made of DNA and a membrane-bound nucleus. The eukaryotes make their own…

Q: Ubiquitylation and phosphorylation are common post-translational modifications. Which of the…

A: In a metabolic process, phosphorylation is the phenomenon in which one phosphorus is attached on a…

Q: Task 2: Review the process of protein synthesis by placing the cards in their appropriate category.

A: The protein synthesis is the anabolic process of the synthesis of the protein by the polymerization…

Q: Assignment 9: Transcribing and Translating a Protein Activity  5.4.1 Synthesis of a Protein: A…

A: 1. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence…

Q: Question 1: Answer all practice question parts Label the leading and lagging strands below: 3' Label…

A: DNA is a genetic molecule which undergoes replication and is required for protein synthesis.

Q: Protein synthesis steps made simple? Step by step to memor

A: Protein synthesis, also known as translation, is the process of creating a polymer of an amino acid…

Q: Base your answer to the question on the diagram below, which represents a process that occurs in…

A: The process by which cells make proteins is known as protein synthesis. Transcription and…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.