Q: You are studying a human gene, and try to express the protein in E. coli bacterial cells. To do…
A: Cloning is the process of creating a genetically identical copy of a biological entity. Cloning can…
Q: DNA sequence
A: This is defined as the process in which cells make proteins. This occurs in 2 stages which include…
Q: The following segment of DNA is part of the RNA-coding sequence of a transcription unit. If the…
A: Introduction Deoxyribonucleic acid is a polymer made of two polynucleotide chains that coil around…
Q: In prokaryotes, the promoter contains a -35 and -10 region upstream of the transcription start site.…
A: Promoter is the sequence in DNA where RNA polymerase is recruited. This is present before the…
Q: A full-length eukaryotic gene is inserted into a bacterial chromosome. The gene contains a complete…
A: The eukaryotic DNA is composed of coding and non-coding sequences, almost 90% are non-coding…
Q: In bacterial genes, as soon as any partial mRNA transcript is produced by the RNA polymerase system,…
A:
Q: The following is part of the non-template strand of DNA for a gene. 5'-TACTATCATGAGAGATAGGAG-3'…
A: Transcription is the process by which the information in a strand of DNA is copied into a messenger…
Q: Some DNA nucleotides are located within the coding regions of genes, where they specify the amino…
A: When transcription activator proteins bind to the regulatory promoter sequences of gene, they…
Q: The following double stranded segment of DNA is part of a protein coding gene. The segments in…
A:
Q: In eukaryotes, the initial transcript, pre-mRNA, must be modified in three ways before it leaves the…
A: The premature mRNA (pre-mRNA) are produced from the DNA template strand within the nucleus of…
Q: If this was an Eukaryote, after this transcript undergoes processing and exits the nucleus what…
A: The question is asking about the structure of a mature mRNA transcript in a eukaryotic cell after it…
Q: . The human gene for ß2 lens crystallin has the components listed below. The numbers represent…
A: Since we only answer up to 3 sub-parts, we’ll answer the first three. Please resubmit the question…
Q: Which of the following mechanisms do prokaryotes use to produce different prdtein products from a…
A: In prokaryotes, the genes encoding proteins of related functions are transcribed under the control…
Q: Shown below is a drawing showing the result of an experiment in which an RNA molecule is allowed to…
A: Answer) The correct option is a) Eukaryotic mRNA. In eukaryotes, The genes contain some non-coding…
Q: mRNA maturation in eukaryotes includes all of the following EXCEPT: A. Topoisomerase activity B.…
A: In eukaryotic cells, the primary transcript undergoes post transcriptional modification to form a…
Q: The sequence below is of the DNA duplex for a gene in which transcription begins with the nucleotide…
A: Transcription is the process of converting a portion of DNA into RNA. RNA polymerase is the enzyme…
Q: Eukaryotic mRNAS have a 5' end while prokaryotic mRNAs do not. O IV.
A: Ans- D Explanation- Eukaryoticic and prokaryotic mRNA are two different mRNAs. Prokaryotic mRNA is…
Q: Initiation of transcription A occurs at terminators B occurs only in eukaryotes C occurs in…
A: The transcription is the process by which the genomic DNA is converted into messenger RNA
Q: The following gene sequence of nucleotides is found on the template (non-coding) strand of a…
A: The sequence would be opposite to template strand and similar to coding strand(except the thiamine…
Q: Which of the following statements about the attempt to express a eukaryotic gene in bacteria is…
A: The regulation of gene expression in eukaryotes occurs at several level, which is far more diverse…
Q: The following sequence is from a region of the M13 bacteriophage genome. Identify and label the…
A: Viruses do not have a living cell like other organisms. They have genetic material encapsulated…
Q: asap please A partially filled diagram of eukaryotic gene structure is shown below. Label the…
A: A typical eukaryotic gene is made up of exons (sequences that appear in mature mRNA) and introns…
Q: A graduate student is trying to identify the gene coding for an enzyme found in a bacterial species…
A: Trinitrotoluene (TNT), a solid organic nitrogen chemical that is mostly utilised as an explosive and…
Q: Splice sites on mRNAs are located with the help of all of the following EXCEPT: Question 9…
A: Introns are cut off at splice sites along a pre-mRNA sequence, and exons are connected at these…
Q: You want to examine genetic variation in your gene promoter. You sequence DNA from several…
A: Single nucleotide polymorphism; it is a type of genetic variation which can occur throughout a…
Q: Bacterial and eukaryotic gene promoters are regions of DNA that contain binding sequences for (Q 10)…
A: DNA and RNA are considered genetic material in the cell. Transcription is a vital process, which…
Q: A normal mRNA that reads 5'- UGCCAUGGUAAUAACACAUGAAGGCCUGAAC-3' was an insertion mutation that…
A: mRNA Messenger RNA or mRNA, it is a single-stranded RNA molecule that is coded into chain of peptide…
Q: The following fictitious double-stranded bacterial DNA sequence codes for a fictitious prot Both…
A: As per the guidelines, this is a question with multi-subparts, we will solve the first three…
Q: Why do humans have such a large number of nucleotides (3.2 billion base pairs) compared to the…
A: The genome is the sum total of all genetic material of an organism which stores biological…
Q: The tollowing mRNA transcript would result in which polypeptide sequence? 5'-ACU UUC ACU AUG UUU UUA…
A: Protein consists of amino acids linked by amide bonds or peptide bonds.
Q: Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and…
A: DNA stands fo deoxyribonucleic acid. It is the genetic material.
Q: What are the specific steps of eukaryotic transcription? Be sure in your discussion that you include…
A: Transcription is the process which consist of several steps of DNA based gene expression.Here a…
Q: Speculate as to why eukaryotes have either a) much more complex promoter and enhancer regions than…
A: In eukaryotes the process of transcription and translation are physically separated because the…
Q: A full-length eukaryotic gene is inserted into a bacterial chromosome. The gene contains a complete…
A: Transcription in eukaryotes occurs in three consequent stages that start with the initiation step,…
Q: In eukaryotes, why is the initial RNA transcript usually longer than the mature mRNA molecule?…
A: Transcription is the process by which messenger rna is made from DNA. This process takes place…
Q: The following is a sample primary RNA transcript. What must first occur before it can be translated?…
A: Introduction Transcription Is The Process Of Copying Information From A Strand Of DNA Into A New…
Q: Below is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very…
A: Introduction Transcription : It Is The Initial Stage In Gene Expression, Which Involves "The…
Q: transcription initiation site GCAGTGACCGGATATAACGAAGAGGAATGCCGTACAAA 5' UCCUUAC 3' Which of the…
A: Coding strand is the that strand of DNA whose sequence is identical to the mRNA sequence while…
Q: Regarding the trp operon: when levels of tryptophan are low, the ___ hairpin forms, resulting in…
A: Trp operon is negatively regulated by tryptophan which means in low concentration of tryptophan the…
Q: Geneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can…
A: DNA is double-stranded, but only one strand serves as a template for transcription at any given…
Q: Hetero Nuclear RNA or hnRNA is the unmodified transcript. What process cuts out pieces of this RNA…
A: Gene expression is the phenomenon by which information in the DNA is translated to produce a…
Q: There may be positive selection on introns if they are adapted to retaining specific stem-loop…
A: Introduction A nucleotide sequence within a gene which is excised out or removed during process…
Q: Shown below are different regions of an eukaryotic gene. Which of the above regions of a gene will…
A: Transcription is the process by which the information in a strand of DNA is copied into a new…
Introns are:
Considered "non-coding" regions |
||
Located in the promoter regions of genes |
||
Found in prokaryotes |
||
A and B |
||
A, B, and C |
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- You just isolated a mutant in the eukaryotic organism C. elegans (aka the world's coolest model organism) that fails to transcribe your favorite gene. Which of the following region(s) are likely to contain your mutation? (You may choose more than one.) Group of answer choices Rut site -10 consensus sequence Rho protein TATA box Sigma subunit binding site Transcription start site26) Eukaryotes are unable to couple transcription and translation because: A) the two processes occur in separate regions of the cell B) they do not have the specialized ribosomes that occur in bacteria C) the genetic code in eukaryotes is incompatible with the formation of polyribosomes D) the mRNA of eukaryotes do not have the appropriate spacers that polycistrons allow for polyribosomes to form E) eukaryotic mRNA molecules are monocistronic. asap please.In eukaryotes there is not a consistent relationship between the length of the coding sequence of a gene and the length of the mature mRNA it encodes, even though one nucleotide in DNA = one nucleotide in pre-mRNA or primary transcript. Explain why this is so.
- The diagram below shows an imaginary eukaryotic structural gene containing two exons. The exon nucleotides are numbered beginning at the transcription start site and a portion of the intron is not shown to save space: Help Center? transcription start site promoter U STACAGTATAAATGAATTAATTGACGTATGTCAATCGGTAAGT...TCAGGTACT U UUU} Phe UUG} Leu exon 1 3 ATGTCATATTTACTTAATTAACTGCATACAGTTAGCCATTCA...AGTCCATGAATGACTTATGTGCGGTTATTTACTGAT... Second letter C Predict the amino acid sequence of the polypeptide encoded by this structural gene. The genetic code is provided below.If a prokaryotic gene coding region is 42 nucleotides long, beginning with a start codon and ending with a stop codon, how many amino acids will it have?Which of the following mutations in the protein-coding region of a gene is more likely to lead to complete loss of function of the encoded protein: an insertion of six nucleotides or a deletion of two nucleotides? Briefly explain your answer.
- Which of the following statements is false? a mutation in a 5' or 3' splice site must alter the sequence of the protein encoded by a gene a missense mutations replaces one amino acid with a different amino acid a mutation in a promoter is unlikely to alter the sequence of the polypeptide encoded by a gene a mutation in a transcriptional terminator is unlikely to alter the sequence of a protein encoded by a gene. a frameshift mutation changes the sequence of a protein 0000MRNAs and eukaryotic cells receive different modifications than those in prokaryotic cells, because eukaryotic mRNAs must be able to accomplish different things. Which of the following describes events that are necessary for an mRNA to be expressed in a eukaryotic cell, but are not necessary for mRNAs in a prokaryotic cell? select all that apply A) introns must be removed from the eukaryotic mRNA B) The mRNA must leave from the nucleus C) transcription factors must bind to the mRNA in a eukaryotic cell after it is transcribed D) A ribsome must bind to the mRNA .Which of the following is NOT a DIFFERENCE between prokaryotic and eukaryotic gene regulation? A. prokaryotic mRNA is NOT capped by a 5’mG after transcription, but eukaryotic mRNA is so capped B. eukaryotic mRNAs are monocistronic (encode single proteins), whereas prokaryotic mRNAs are polycistronic (encode multiple proteins) C. prokaryotic mRNA is not modified by polyadenylation after transcription, but eukaryotic mRNA is so modified. D. translation of eukaryotic mRNA into protein is not coupled to transcription of the mRNA from DNA, but in prokaryotes it is so coupled E. prokaryotic translation and eukaryotic translation use different genetic codes to translate mRNA codons into amino acid sequences of proteins
- Which of the following statements is false? a mutation in a 5' or 3' splice site must alter the sequence of the protein encoded by a gene a mutation in a transcriptional terminator is unlikely to alter the sequence of a protein encoded by a gene. a mutation in a promoter is unlikely to alter the sequence of the polypeptide encoded by a gene a missense mutations replaces one amino acid with a different amino acid a frameshift mutation changes the sequence of a protein 000 0As described earlier, DNA damage can cause deletion or insertion of base pairs. If a nucleotide base sequence of a coding region changes by any number of bases other than three base pairs, or multiples of 3, a frameshift mutation occurs. Depending on the location of the sequence change, such mutations can have serious effects. The following synthetic mRNA sequence codes for the beginning of a polypeptide: 5′-AUGUCUCCUACUGCUGACGAGGGAAGGAGGUGGCUUAUC-AUGUUU-3′ First, determine the amino acid sequence of the polypeptide. Then determine the types of mutation that have occurred in the following altered mRNA segments. What effect do these mutations have on the polypeptide products? a. 5′-AUGUCUCCUACUUGCUGACGAGGGAAGGAGGUGGCUUAUCA-UGUUU-3′ b. 5′-AUGUCUCCUACUGCUGACGAGGGAGGAGGUGGCUUAUCAU-GUUU-3′ c. 5′-AUGUCUCCUACUGCUGACGAGGGAAGGAGGUGGCCCUUAUC-AUGUUU-3′ d. 5′-AUGUCUCCUACUGCUGACGGAAGGAGGUGGCUUAUCAU-GUUU-3′
![Human Anatomy & Physiology (11th Edition)](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
![Biology 2e](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
![Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
![Molecular Biology of the Cell (Sixth Edition)](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
![Laboratory Manual For Human Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
![Inquiry Into Life (16th Edition)](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)
![Human Anatomy & Physiology (11th Edition)](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
![Biology 2e](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
![Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
![Molecular Biology of the Cell (Sixth Edition)](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
![Laboratory Manual For Human Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
![Inquiry Into Life (16th Edition)](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)