Q: Chaperones are: please explain the answer a.proteins that promote proper amino acid incorporation…
A: Proteins are a class of complex nitrogenous organic compounds, composed of amino acid residues…
Q: point mutations that affect the amino acid sequence of a protein include, frameshift mutations,…
A: ANSWER : Absolutely, let's delve into missense mutations and how they can influence protein…
Q: b. The process by which the DNA instructions are converted into the functional product is called…
A: DNA m-RNA A U G C G C T A T A A U C G T A G C
Q: Cystic Fibrosis is a genetically heritable disease caused by the loss of the chloride channel, CFTR.…
A: Cystic fibrosis is a genetic disease that is characterized by the production of excessively thick…
Q: Suppose you carry out genomic, transcriptomic, and proteomicstudies on a single tissue. What type of…
A: Omics is the informal branch of biology that includes disciplines like transcriptomics,…
Q: Mutations in the CFTR gene can cause a disease that affects the entire organism. Arrange these…
A: Genetics is a part of science worried about the investigation of genes, genetic variety, and…
Q: Dystrophin is a protein that forms part of a vital protein complex that connects the cytoskeleton of…
A: Genetic Disorders are disease conditions in the body that occur as a result of gene mutations or…
Q: Part of being a detective is being able to decode secret messages left behind by certain…
A: The given DNA sequence is: 5'- TATGCTAGGCATTGTCGTAGGCATACG -3' 3'- ATACGATCCGTAACAGCATCCGTATGC -5'
Q: Geneticists are studying a malfunctioning protein that causes impaired endothelial cell migration…
A: The translation is a process of conversion of RNA codon sequences into their respective amino acid…
Q: you to NSTRUCTIONS: Try to re-arrange or unscramble the words below. 1. EXONTIMYLHA 2. NVA GSINEOS…
A: Histology is a branch of biology in which study on tissue is done. The histological techniques deals…
Q: Answer the two parts of the question. a) Explain what gene therapy involves. b) Discuss how gene…
A: Gene therapy presents one of the best technical difficulties in current medicine. It is…
Q: In a world of advancing technologies and innovative health care, some individuals would rather rely…
A: Gene therapy is an experimental technique in which genes are used to treat or prevent diseases or…
Q: Beadle and Tatum's experiments led to the "one gene - one enzyme (protein)" hypothesis. In…
A: The genes are the functional part of the DNA that are responsible for the production of RNA by the…
Q: Protein structure is central to our understanding biological systems. The tubular proteins that make…
A: Primary, secondary, tertiary, and quaternary structures are the four levels of complexity that can…
Q: A KDEL sequence is necessary for ... Select an answer and submit. For keyboard navigation, use the…
A: According to certain theories, the KDEL receptor controls COPI transport. The development of COPI…
Q: The following segment of DNA codes a protein. The uppercase letters represent exons, the lowercase…
A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum…
Q: Cystic fibrosis (CF) is a disorder caused by a random change in the gene that produces the cystic…
A: Cystic fibrosis is a genetic disorder that affects the lungs and digestive system. It is caused by a…
Q: Anna gave birth to her first child 6 months ago. She has noticed that her child is NOT advancing as…
A: Anna gave birth to her first child 6 months ago. She has noticed that her child is NOT advancing as…
Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…
A: Introduction : The genetic code is the set of rules by which information encoded within genetic…
Q: What is a gene ? A- A molecule of DNA , which is transformed into a protein to be used by the cell…
A: Answer. Mendel used the term factor for a gene. Johannsen in 1909 named these units as Genes. Gene…
Q: 8) What makes a liver cell a liver cell and not a brain cell? A) The fact that it is found in an…
A: Introduction :- Hepatic cells are the most prevalent cells in the liver, making up nearly 90% of all…
Q: What does the acronym AGP represent?
A: Plant cell wall contains a wide group of hydroxyproline rich glycoproteins. One type of…
Q: Choose the option that goes with the blank. The parentheses after the blank are the choices.…
A: Codon are sequence of 3 Nucleotide bases on mRNA that code for specific amino-acid. Anticodon are…
Q: The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to…
A: The transcription is the process by which RNA is produced from the temple strand of the DNA. Then…
Q: Consider Molecule X, which is found in all living cells. Each form of this molecule is keyed to the…
A: RNA, or ribonucleic acid, is a molecule that plays a crucial role in various biological processes.…
Proteins
We generally tend to think of proteins only from a dietary lens, as a component of what we eat. However, they are among the most important and abundant organic macromolecules in the human body, with diverse structures and functions. Every cell contains thousands and thousands of proteins, each with specific functions. Some help in the formation of cellular membrane or walls, some help the cell to move, others act as messages or signals and flow seamlessly from one cell to another, carrying information.
Protein Expression
The method by which living organisms synthesize proteins and further modify and regulate them is called protein expression. Protein expression plays a significant role in several types of research and is highly utilized in molecular biology, biochemistry, and protein research laboratories.
In which tissue(s) is your protein NOT expressed in?
1. Go to: https://www.proteinatlas.org/
2. Type the name of your protein in the search bar. Click "Search" 3. Click on the gene name of your protein
4. Click on the "Tissue" icon
A.Blood
B.Brain
C.Pancreas
D.Adipose and soft tissue Eye
Step by step
Solved in 2 steps with 2 images
- If you had cancer, would you donate tissue samples to this project? Would you want to know about privacy issues and the possible release of parts of your medical records?A couple has had a child born with neurofibromatosis. They come to your genetic counseling office for help. After taking an extensive family history, you determine that there is no history of this disease on either side of the family. The couple wants to have another child and wants to be advised about the risks of that child having neurofibromatosis. What advice do you give them?Should he go ahead and enroll on the chance that he would receive the DNA vaccine and that it would be more effective than chemotherapy? Bruce and his parents moved to a semi-tropical region of the United States when he was about 3 years old. He loved to be outside year-round and swim, surf, snorkel, and play baseball. Bruce was fair-skinned, and in his childhood years, was sunburned quite often. In his teen years, he began using sunscreens, and although he never tanned very much, he did not have the painful sunburns of his younger years. After graduation from the local community college, Bruce wanted an outdoor job and was hired at a dive shop. He took people out to one of the local reefs to snorkel and scuba dive. He didnt give a second thought to sun exposure because he used sunscreen. His employer did not provide health insurance, so Bruce did not go for annual checkups, and tried to stay in good health. In his late 20s, Bruce was injured trying to keep a tourist from getting caught between the dive boat and the dock. He went to an internist, who treated his injury and told Bruce he was going to give him a complete physical exam. During the exam, the internist noticed a discolored patch of skin on Bruces back. She told him that she suspected Bruce had skin cancer and referred him to a dermatologist, who biopsied the patch. At a follow-up visit, Bruce was told that he had melanoma, a deadly form of skin cancer. Further testing revealed that the melanoma had spread to his liver and his lungs. The dermatologist explained that treatment options at this stage are limited. The drugs available for chemotherapy have only temporary effects, and surgery is not effective for melanoma at this stage. The dermatologist recommended that Bruce consider entering a clinical trial that was testing a DNA vaccine for melanoma treatment. These vaccines deliver DNA encoding a gene expressed by the cancer cells to the immune system. This primes the immune system to respond by producing large quantities of antibodies that destroy melanoma cells wherever they occur in the body. A clinical trial using one such DNA vaccine was being conducted at a nearby medical center, and Bruce decided to participate. At the study clinic, Bruce learned that he would be in a Phase Ill trial, comparing the DNA vaccine against the standard treatment, which is chemotherapy, and that he would be randomly assigned to receive either the DNA vaccine or the chemotherapy. He was disappointed to learn this. He thought he would be receiving the DNA vaccine.
- The following family has a history of inherited breast cancer. Betty (grandmother) does not carry the gene. Don, her husband, does. Dons mother and sister had breast cancer. One of Betty and Dons daughters (Sarah) has breast cancer; the other (Karen) does not. Sarahs daughters are in their 30s. Dawn, 33, has breast cancer; Debbie, 31, does not. Debbie is wondering if she will get the disease because she looks like her mother. Dawn is wondering if her 2-year-old daughter (Nicole) will get the disease. a. Draw a pedigree indicating affected individuals and identify all individuals. b. What is the most likely mode of inheritance of this trait? c. What are Dons genotype and phenotype? d. What is the genotype of the unaffected women (Betty and Karen)? e. A genetic marker has been found that maps very close to the gene. Given the following marker data for chromosomes 4 and 17, which chromosome does this gene map to? f. Using the same genetic marker, Debbie and Nicole were tested. The results are shown in the following figure. Based on their genotypes, is either of them at increased risk for breast cancer?The genetic structures located within the nucleus of each cell are known as _______________________ These structures are made up of the DNA molecules containing the bodys genes.The food label in Figure 11.28 lists the nutrients and other substances in a package of ready-to-eat macaroni and cheese. Based on your reading in this chapter, how would you rate this products healthiness in terms of fats and carbohydrates? Figure 11.28 Food labels are useful health tools. Information on a food label can be used to ensure that you get the nutrients you need without exceeding recommended limits on less healthy substances such as salt, sugar, and trans fats. At present, the USDA is considering major revisions to food labels. The proposed changes include showing realistic serving sizes and sugars added by the manufacturer, and printing the calorie content per serving in larger, bolder type so that it is easier for consumers to make informed choices about purchases of prepared foods. (Left: USDA, US Department of Agriculture; Right: FoodCollection/SuperStock)
- James sees an online ad for an at-home genetic test that promises to deliver personalized nutritional advice based on an individuals genetic profile. The company can test for genetic variations, the advertisement states, that predispose individuals to developing health conditions such as heart disease and bone loss or that affect how they metabolize certain foods. If such variations are detected, the company can provide specific nutritional advice that will help counteract their effects. Always keen to take any steps available to ensure the best possible health for their family, James and his wife (Sally) decide that they both should be tested, as should their 11-year-old daughter (Patty). They order three kits. Once the kits arrive, the family members use cotton swabs to take cell samples from their cheeks and place the swabs in individually labeled envelopes. They mail the envelopes back to the company, along with completed questionnaires regarding their diets. Four weeks later, they receive three individual reports detailing the test results and providing extensive guidelines about what foods they should eat. Among the results is the finding that James has a particular allele in a gene that may make him vulnerable to the presence of free radicals in his cells. The report suggests that he increase his intake of antioxidants, such as vitamins C and E, and highlights a number of foods that are rich in those vitamins. The tests also show that Sally has several genetic variations that indicate that she may be at risk for elevated bone loss. The report recommends that she try to minimize this possibility by increasing her intake of calcium and vitamin D and lists a number of foods she could emphasize in her diet. Finally, the report shows that Patty has a genetic variation that may mean that she has a lowered ability to metabolize saturated fats, putting her at risk for developing heart disease. The report points to ways in which she can lower her intake of saturated fats and lists various types of foods that would be beneficial for her. A number of companies now offer genetic-testing services, promising to deliver personalized nutritional or other advice based on peoples genetic profiles. Generally, these tests fall into two different categories, with individual companies offering unique combinations of the two. The first type of test detects alleles of known genes that encode proteins that play an established role in, for example, counteracting free radicals in cells or in building up bone. In such cases, it is easy to see why individuals carrying alleles that may encode proteins with lower levels of activity may be more vulnerable to free radicals or more susceptible to bone loss. A second type of test examines genetic variations that may have no clear biological significance (i.e., they may not occur within a gene or may not have a detectable effect on gene activity) but have been shown to have a statistically significant correlation with a disease or a particular physiological condition. For example, a variation may frequently be detected in individuals with heart disease even though the reason for the correlation between the variation and the disease may be entirely mysterious. Do James and Sally have any guarantees that the tests and recommendations are scientifically valid?James sees an online ad for an at-home genetic test that promises to deliver personalized nutritional advice based on an individuals genetic profile. The company can test for genetic variations, the advertisement states, that predispose individuals to developing health conditions such as heart disease and bone loss or that affect how they metabolize certain foods. If such variations are detected, the company can provide specific nutritional advice that will help counteract their effects. Always keen to take any steps available to ensure the best possible health for their family, James and his wife (Sally) decide that they both should be tested, as should their 11-year-old daughter (Patty). They order three kits. Once the kits arrive, the family members use cotton swabs to take cell samples from their cheeks and place the swabs in individually labeled envelopes. They mail the envelopes back to the company, along with completed questionnaires regarding their diets. Four weeks later, they receive three individual reports detailing the test results and providing extensive guidelines about what foods they should eat. Among the results is the finding that James has a particular allele in a gene that may make him vulnerable to the presence of free radicals in his cells. The report suggests that he increase his intake of antioxidants, such as vitamins C and E, and highlights a number of foods that are rich in those vitamins. The tests also show that Sally has several genetic variations that indicate that she may be at risk for elevated bone loss. The report recommends that she try to minimize this possibility by increasing her intake of calcium and vitamin D and lists a number of foods she could emphasize in her diet. Finally, the report shows that Patty has a genetic variation that may mean that she has a lowered ability to metabolize saturated fats, putting her at risk for developing heart disease. The report points to ways in which she can lower her intake of saturated fats and lists various types of foods that would be beneficial for her. A number of companies now offer genetic-testing services, promising to deliver personalized nutritional or other advice based on peoples genetic profiles. Generally, these tests fall into two different categories, with individual companies offering unique combinations of the two. The first type of test detects alleles of known genes that encode proteins that play an established role in, for example, counteracting free radicals in cells or in building up bone. In such cases, it is easy to see why individuals carrying alleles that may encode proteins with lower levels of activity may be more vulnerable to free radicals or more susceptible to bone loss. A second type of test examines genetic variations that may have no clear biological significance (i.e., they may not occur within a gene or may not have a detectable effect on gene activity) but have been shown to have a statistically significant correlation with a disease or a particular physiological condition. For example, a variation may frequently be detected in individuals with heart disease even though the reason for the correlation between the variation and the disease may be entirely mysterious. Do you think that companies should be allowed to market such tests directly to the public, or do you believe that only a physician should be able to order them?James sees an online ad for an at-home genetic test that promises to deliver personalized nutritional advice based on an individuals genetic profile. The company can test for genetic variations, the advertisement states, that predispose individuals to developing health conditions such as heart disease and bone loss or that affect how they metabolize certain foods. If such variations are detected, the company can provide specific nutritional advice that will help counteract their effects. Always keen to take any steps available to ensure the best possible health for their family, James and his wife (Sally) decide that they both should be tested, as should their 11-year-old daughter (Patty). They order three kits. Once the kits arrive, the family members use cotton swabs to take cell samples from their cheeks and place the swabs in individually labeled envelopes. They mail the envelopes back to the company, along with completed questionnaires regarding their diets. Four weeks later, they receive three individual reports detailing the test results and providing extensive guidelines about what foods they should eat. Among the results is the finding that James has a particular allele in a gene that may make him vulnerable to the presence of free radicals in his cells. The report suggests that he increase his intake of antioxidants, such as vitamins C and E, and highlights a number of foods that are rich in those vitamins. The tests also show that Sally has several genetic variations that indicate that she may be at risk for elevated bone loss. The report recommends that she try to minimize this possibility by increasing her intake of calcium and vitamin D and lists a number of foods she could emphasize in her diet. Finally, the report shows that Patty has a genetic variation that may mean that she has a lowered ability to metabolize saturated fats, putting her at risk for developing heart disease. The report points to ways in which she can lower her intake of saturated fats and lists various types of foods that would be beneficial for her. A number of companies now offer genetic-testing services, promising to deliver personalized nutritional or other advice based on peoples genetic profiles. Generally, these tests fall into two different categories, with individual companies offering unique combinations of the two. The first type of test detects alleles of known genes that encode proteins that play an established role in, for example, counteracting free radicals in cells or in building up bone. In such cases, it is easy to see why individuals carrying alleles that may encode proteins with lower levels of activity may be more vulnerable to free radicals or more susceptible to bone loss. A second type of test examines genetic variations that may have no clear biological significance (i.e., they may not occur within a gene or may not have a detectable effect on gene activity) but have been shown to have a statistically significant correlation with a disease or a particular physiological condition. For example, a variation may frequently be detected in individuals with heart disease even though the reason for the correlation between the variation and the disease may be entirely mysterious. What kinds of regulations, if any, should be in place to ensure that the results of these tests are not abused?
