In the figure below, Km is indicated at position labeled B Initial velocity (μM product/s) 50 45 40 35 20 15 5 0 0 50 D 100 150 200 [S] (μm) High [E] Low [E] 250 300 350
Q: 1. Explain the stepwise breakdown of starch. 2. Discuss the role of undigestible carbohydrates in…
A: Starch is a polysaccharide, made up of two units; namely amylose (α 1-4 linkage) and amylopectin (α…
Q: Chemistry help
A: pI (isoelectric point) is the PH at which a molecule carries no net charge. Isoelectric focusing is…
Q: In most enzymes, the required active site amino acids consists of only a few residues. Why is the…
A: Enzymes are proteins that function as biocatalysts and catalyse biochemical reactions.They have a…
Q: reaction of glyceraldehyde-3-phosphate to form dihydroxyacetone phosphate
A: Glycolysis is a collection of 10 enzymatically catalysed reactions that sequentially oxidise a…
Q: Indicate whether the following pairs of monosaccharides are aldoses or ketoses. a. D-altrose &…
A: INTRODUCTION : Monosaccharides : They are also known as simple sugar. They are the simplest forms of…
Q: Calculate 1/[S] and 1/V to complete the table. Use this data to draw a Lineweaver-Burke plot, with…
A: A Lineweaver-Burk plot represents the relationship between the reciprocal values of substrate…
Q: impact on the number of electron carriers used by the electron transport chain? Select one: The…
A: Introduction Cellular respiration is of two types: aerobic respiration and anaerobic respiration.…
Q: Bacteria and other prokaryotic cells have the capacity to get more ATP/glucose oxidized than…
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Formation of a GC-rich stem-loop in the mRNA is required for function of an intrinsic transcription…
A: Transcription is the process in which mRNA corresponding to a gene is synthesized by RNA Polymerase.…
Q: 12. The graph shows values of arterial plasma bicarbonate concentration and pH for different persons…
A: Metabolic alkalosis is caused by acid base imbalance in the blood. It is characterised by increase…
Q: Refer to the chromatograph (Figure 1) below and answer the questions that follow: What is the…
A: Affinity chromatography is a separation technique that takes advantage of the ligand specificity…
Q: Which of the following statements is CORRECT? A) Hexokinase IV is allosterically inhibited by…
A: Enzyme plays an important role in all the metabolic activities in our body. They themselves remain…
Q: 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids:
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: 13. How would ATP production in an aerobic yeast culture change if we add the following metabolites…
A: Aerobic yeast culture is a metabolic process in which glucose is metabolize by fermentation even in…
Q: What are the essential amino acids and how does the body get them? Give an example of one of them…
A: DISCLAIMER FOR MULTIPART Since you have posted a question with multiple sub-parts, we will solve…
Q: Chemistry When the steady-state concentration of a drug on one side of the membrane is 5 micromolar…
A: According to Fick's first law, dC/dt= K(C1-C2)/h
Q: Which one of the following amino acids is phosphorylated during the process of promoter clearance by…
A: In eukaryotes RNA Polymerase II is responsible for the synthesis of mRNA. The largest subunit of Pol…
Q: ) How many moles of ATP can be gained from the catabolism of the following substrates to pyruvate?…
A: Since you have asked multiple questions with multiple subparts, we will solve the first question for…
Q: INFLUENCE OF FREE ACID tt #1 tt #2 tt #3 tt #4 CONDITION 4 mL 0.2% HCI + 1 mL starch paste + 1 drop…
A: Effect of saliva on starch: Saliva contains the digesting enzyme amylase, which breaks down starch.…
Q: 1. Calculate the size of the resulting fragments as they will occur after digestion and write the…
A: Lambda DNA is a linear DNA extracted from E coli bacteriophage with 485052 base pairs (bp) At each…
Q: H K Br Br H trans-2,3-dibromo-2-butene cis-1,2-dibromoethene Otrans-1,2-dibromoethene…
A: The structure given the question represents- Answer- trans - 1,2- dibromoethene
Q: What are the components of a nucleotide? Provide 1- or 2-sentence description of each component.
A: Nucleic acids are biomolecules that are essential for all life forms. They are polymers of…
Q: Question 21 of 25 What are Gram-negative bacteria? Select the correct response(s): They have a cell…
A:
Q: Whether done manually or automated, DNA sequencing gels are always made of polyacrylamide rather…
A: Sequencing DNA entails finding the order of the four chemical building components known as "bases"…
Q: Using an arrow, draw the site of cleavage for the following peptides that are reacted by: Pepsin…
A: Amino acids are building blocks of peptides and polypeptide chain. Peptides are consist of 2-50…
Q: Consider a uniport system where a carrier protein transports an uncharged substance A across a cell…
A: ∆G = R T ln (Ainside /Aoutside) Where G is free energy change for the transport of uncharged…
Q: How many glucose and amino acid molecules need to be used in order to obtain the same amount of…
A: Glucose is oxidized through glycolysis and the TCA cycle in aerobic conditions. Fatty acids are…
Q: Search the protein data bank (https://www.rcsb.org/)and find an image of one protein that is found…
A: The SARS-CoV-2 virus is the infectious disease known as coronavirus disease (COVID-19). A group of…
Q: The first reaction in glycolysis is the phosphorylation of glucose to form glucose 6-phosphate: P: +…
A: Given Values: ∆G°=13.8 kJ/mol or 13800 J/mol[Pi] = 5 mM[Glucose] = 5 mM
Q: Which of the following laws of matter best describes the statements on sulfide minerals? Select one:…
A: INTRODUCTION : Sulfide minerals - They are a class of minerals consisting of sulfide or disulfide…
Q: When disaccharides are heated in the presence of a strong acid, the linkage joining the two…
A: There are four types of biological macromolecules, nucleic acids, proteins, carbohydrates and…
Q: 16. If the aerobic catabolism of 1 mol of glucose yields 38 mol of ATP, and the energy released by…
A: "Since you have asked multiple questions, we will solve the first question for you. If you want a…
Q: Consider the pyruvate carboxylase reaction, the first bypass step in gluconeogenesis: Pyruvate + CO₂…
A: Gluconeogenesis is a process by which cells make glucose from non carbohydrate sources.…
Q: In a Myoglobin and azide ligand-receptor binding experiment, instead of using 3.5 µM myoglobin you…
A: Myoglobin acts as oxygen reserve in the muscle cells. Myoglobin (Mb) has higher affinity towards…
Q: Give the isoelectric points of following 2 tripeptides DRI and RID.
A: pI (isoelectric point) of an amino acid is the PH at which the amino acid carries zero net charge. A…
Q: Given that the reduction potential Eo'= -320, +10, +816, and +50mV for NAD+, fumarate, O₂ and…
A: An oxidizing species is the substance that donates electrons, and a reducing species is the…
Q: 11. Use the data below to answer the following question: How much more energy is stored in a gram of…
A: Glycogen and fat are two molecules used by human body to store energy. The inside and even outside…
Q: There are some cells in our bodies (stem cells) that are able to form new structures even in adults.…
A: Stem cells are undifferentiated cells In our body that can turn into any specific cells, as per the…
Q: Describe the mechanism of feedback inhibition and the role this process plays in controlling enzyme…
A: The process of enzyme inhibition that is induced by the end product of a reaction to prevent the…
Q: What is most correct about the following inhibition? Penicillin
A: The antibiotic penicillin irreversibly binds to and inhibits the activity of the transpeptidase…
Q: H₂C-O-C-(CH₂) 16CH3 i HC-0- H₂C-O-C-(CH₂) 14CH3 (a) -(CH₂)7CH=CH(CH₂)7CH3 H₂C-O-C-(CH₂) 14CH3 요…
A: Fats and oils are triglycerides or triacylcylgerols. They are esters which three fatty acid are…
Q: How can chirality and stereoisomers influence the pharmacology, bioactivity, toxicology,…
A: Ibuprofen is a Non-Steroidal Anti-Inflammatory Drug (NSAID). Ibuprofen does this function by…
Q: vo (μM/min) 25 20 15 10 5 0 7 VO (μM/min) VS pH 8 pH 9.5 10.4
A: Enzymes are the catalysts that function to increase the rate of reaction by decreasing their…
Q: Gluconeogenesis occurs in muscle using the enzyme glucose-6-phosphatase. True False
A: The term "gluconeogenesis" describes a collection of metabolic processes that take place in the…
Q: Experiment: Action of Bromelain in the Setting of Gelatin Why were the results of the freshly…
A: Bromelain is type of proteolytic enzyme that is found in pineapple. It digests the fibrinogen and…
Q: The following are true of the mitochondrial structure I. The inner mitochondrial membrane is…
A: Mitochondria are power house of cell, known to synthesize ATP. They are membrane bound organelles…
Q: Cholesterol Synthesis and Metabolism Q6.2: Describe the TWO major discoveries from the Goldstein…
A: Cholesterol is a type of lipids or modified sterols which is a vital component of cell membrane and…
Q: Hair is comprised largely of keratin, a fibrous protein consisting of two a-helices wrapped around…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: 3. Briefly describe and explain the shape of the curve in Q2.
A: In an enzyme-catalysed reaction, the substrate binds reversibly to the enzyme's active site to form…
Q: True or False for each question ( ) Guanine, Adenine, Uracil, and Cytosine are commonly found…
A: The biological macromolecules are classified as nucleic acids, proteins, lipids and carbohydrates.…
![OA
OD
Ов
C](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2Fe79e447c-3f6b-4a30-be90-22f44f8c8395%2F1ef42876-6a97-445d-9d73-efa0673b4278%2Fmpap633_processed.jpeg&w=3840&q=75)
![In the figure below, Km is indicated at position labeled_
B
U
Initial velocity (μM product/s)
50
45
40
35
20
15
5
0
0
50
D
100
150 200
[S] (μm)
High [E]
Low [E]
A
250 300 350](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2Fe79e447c-3f6b-4a30-be90-22f44f8c8395%2F1ef42876-6a97-445d-9d73-efa0673b4278%2F0izktp_processed.jpeg&w=3840&q=75)
![](/static/compass_v2/shared-icons/check-mark.png)
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- Use MS Excel to plot and determine the terms being asked: Please insert the excel file, thank you For each V (mmol/min), determine the value of [S] (mM) if Vmax = 5 mmol/min. Show your calculations. Using MS Excel, plot [S] (mM) versus V (mmol/min). Draw a line corresponding to the given Vmax parallel the x-axis and extend your plotted line to show its approach to Vmax. Provide your final plot [S] (mM) V (mmol/min) 10 1.2 1.7 2.1 2.2 2.5 Determine the values of Km and Vmax for the decarboxylation of β-keto acid given the following data. Please show and label your plot. Show your calculations and box your final [S] in mol/l V in mM/ min 2.500 0.588 1.000 0.500 0.714 0.417 0.526 0.370 0.250 0.256Imagine you will use a centrifuge in the laboratory indicating rpm and your protocol requires 3500xg, what would your setting be in a given centrifuge with a radius of 10cm? Provide computationsYou have measured the following data for enzyme X. Substrate Vo concentration (micromolar (mM) Isec) 0.05 10 0.1 60 0.5 175 1 250 350 490 10 492 20 494 50 499 100 498 200 498
- The usual dose of digoxin for rapid digitalization is a total of 1.0mg, divide into two or more portion at intervals of 6 to 8 hours. How many milliliters of digoxin elixir containing 50mcg/mL would provide this dose?Consider a bi convex lens with radius of curvatures |R1| = 30 mm and |R2| = 180 mm, ct = 5 mm and glass is N-BK7. This is used as camera lens in order to image a man who is at 1 km away from the camera. We want to resolve 10 cm on his body. Assume that λ = 550 nm. Using zemax, determine the MTF value for the resolution of R = 80 lp / mm in image plane which is placed at paraxial focus. (Hint: First, find the diameter of the lens) Which one: a.32.1 % b.28.7 % c.12.3 % d.58.5 % e.46.8 % f.57.2 % g.20.9 % h.15.6 %What is v/Vmax ratio when [S] = 4km? %3D
- Using the formula V₁D₁ = V₂D2, what volume of a 1/100 (10-2) dilution would you need to produce 100 mL of a 1/10000 (10-4) dilution? (Note: provide your answer in decimal format to three decimal places.)BSA Concentration (ug/mL) Abs 2000 2.25 1500 1.715 1000 0.915 750 1.156 500 0.714 250 0.082 125 0.086 25 0.082 Create a BSA standard curve Abs562=f[BSA] using a Scatter Plot representation in Excel.p = sqrt(1/8500) = 0.00235 I think this is incorrect
- Calculate: 0.08cm+2.63mm+0.022m+320µm. Give the result in millimeters (Do not round up or down the result. Write all figures: ex: 23.57 or 65.1). Pradice qi6 Your Answer: AnswerA Br selective electrode is applied for measuring bromide ions in saline solution. Cl' ions were found to interfere, with a kPot = 0.0050. %3D After calibration, the ISE equation was determined to be y = -70 mV - 59.2mV*log(x). If we measure a potential of 93 mV, and the [CI]=0.100 M, what was the [Br'] in units of M? O 0.00821 O 0.100 O 0.0050 O 0.123 O Correct answer not found in other optionsCreate one bar graph summarizing both the Tewameter and Corneometer readings (mention this graph in the text as Figure 1) Give a short description of Figure 1 as figure title (Figure 1) Label both axes On the graph, plot the average numbers and standard deviation, not the individual measurements Standard deviation should be displayed on the top of the average bars as an error bar