In a mixed heteropolymer experiment, messages were createdwith either 4/5C:1/5A or 4/5A:1/5C. These messages yielded proteinswith the amino acid compositions shown in the followingtable. Using these data, predict the most specific coding compositionfor each amino acid.4/5C:1/5A 4/5A:1/5CPro 63.0% Pro 3.5%His 13.0% His 3.0%Thr 16.0% Thr 16.6%Glu 3.0% Glu 13.0%Asp 3.0% Asp 13.0%Lys 0.5% Lys 50.0% 98.5% 99.1%

In a mixed heteropolymer experiment, messages were createdwith either 4/5C:1/5A or 4/5A:1/5C. These messages yielded proteinswith the amino acid compositions shown in the followingtable. Using these data, predict the most specific coding compositionfor each amino acid.4/5C:1/5A 4/5A:1/5CPro 63.0% Pro 3.5%His 13.0% His 3.0%Thr 16.0% Thr 16.6%Glu 3.0% Glu 13.0%Asp 3.0% Asp 13.0%Lys 0.5% Lys 50.0% 98.5% 99.1%

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter10: From Proteins To Phenotypes

Section: Chapter Questions

Problem 10QP: b. Compounds A, B, C, and D are known to be intermediates in the pathway for production of protein...

See similar textbooks

Related questions

Q: Which of the following plates could represent the results of the transformation experiment with PGLO…

A: INTRODUCTION Transformation is a genetic exchange mechanism by which “naked” DNA is taken up by…

Q: Mammalian cells growing in culture were labeled with [3H]-thymidineto estimate the rate of DNA…

A: Mammalian cells growing in culture were labeled with [3H]-thymidineto estimate the rate of DNA…

Q: Amino acid sequence analysis of all of the peptides found in a single IgG antibody would reveal…

A: Antibodies are made of immunoglobulin (Ig) units. They are associated with the immune system and are…

Q: 7. In the 1940s, Avery, MacLeod and McCarty, performed biochemical analyses of Griffith's…

A: In 1928, Frederick Griffith, in a series of experiments with Streptococcus pneumonia witnessed, a…

Q: The Alu 1 enzyme comes at a concentration of 5,000 U/ml. Its buffer comes 10X. The DNA is at a…

A: Given,- Alu 1 enzyme concentration: 5,000 U/ml- Alu 1 enzyme buffer concentration: 10X- DNA…

Q: A different Fab fragment binds to lysozyme with a dissociation constant of Ka = 10-6 M. A 1 nM (10-9…

A: Ligand receptor complex is a term used to describe the non-covalent interaction between a ligand and…

Q: A hexapeptide of unknown sequence was isolated from an amphibian skin then sequenced. The following…

A: Hi! Thanks for your question but the data are insufficient for solving the queries. I am writing…

Q: The buffers used for the IMAC separation of His-tagged GFP method represent a typical biotech lab…

A: Immobilized metal affinity chromatography (IMAC) is a method of protein separation based on the…

Q: A scientist is researching GS1, an enzyme with a relative molecular mass (Mr) of 78,000 present in a…

A: Enzymes are biocatalysts that increase the velocity of biological reactions. Enzymes act on specific…

Q: The E coli cell contains 107 non-specific DNA binding sites for R, 10 R molecules, and 1 Operator.…

A: In molecular biology, the particular binding of a regulatory protein to DNA could be a common…

Q: The concentration of RNase that Christian Anfinsen used in his denaturation/renaturation experiments…

A: Anfinsen's work demonstrated that the native structure of ribonuclease will form after denaturation…

Q: All questions a) State the type of gene mutation shown in Figure 2. b) Name the genetic disorder…

A: Genetic mutation is the permanent alteration in the DNA sequence that make up the gene. The…

Q: For E. coli strains with the lac genotypes show below, use a plus sign (+) to indicate the synthesis…

A: Lactose operon is an inducible operon in prokaryotes. the operon is the gene regulation system in…

Q: [Select] Table 2 [Select] Xgal glucose > Xgal + lactose [Select] [Select] Minimal lactose ΝΑ >…

A: In the laboratory setting, it is common to study and analyze various mutants of microorganisms to…

Q: Please explain

A: Lane A:* DNA sample: Human genomic DNA* Enzyme: EcoRI (5' G^AATTC 3')Lane B:* DNA sample:…

Q: You start with 100 units of protein activity and 100 grams of total protein. After the first…

A: Protein purification is performed to purify a target protein from a mixture of proteins. Fold…

Q: You have discovered a novel protein that has a pI = 5.5. To study the functional properties of this…

A: The functional properties of the new protein, has two amino acid changes—namely, a surface Phe…

Q: The gene encoding the E. coli enzyme enolase begins with the sequence ATGTCCAAAATCGTA. What is the…

A: The flow of genetic information from DNA to RNA and then RNA to protein is called central dogma. It…

Q: The pathway for arginine biosynthesis in Neurospora crassa involves several enzymes that produce a…

A: Introduction :- Arginine is an amino acid that plays an important role in various biological…

Q: Below are shown two views of the backbone representation of the Myc-Max complex binding to DNA (PDB…

A: DNA ( Deoxyribonucleic acid) is the hereditary molecule of organism as it flows from one generation…

Q: Beer's Law to determine Protein Concentration You have purified a recombinant form of the p53…

A: The determination of protein concentration is necessary for diverse biochemical experiments. The…

Q: In a mixed copolymer experiment, messages were created witheither 4/5C : 1/5A or 4/5A : 1/5C. These…

A: The genetic code is a system of triple letter codons that are made up of a combination of the…

Q: enzymes being used here are at a concentration of 10 U/uL. For double digests, give the appropriate…

A: The required concentration of plasmid DNA is 1 ug in 20 ul of total final volume.

Q: With this DNA sequenec: - 5'-GCAATGGAGAGAATCTGCGCG-3'- - 3'-CGTTACCTCTGTTAGACGCGC-5' - -Identify the…

A: The process by which DNA gets converted into RNA molecule is called as transcription and then mRNA…

Q: nder what conditions will the following partial diploid strain of E. coli convert chorismate to…

A: Tryptophan is used by the body to make melatonin and serotonin. Melatonin aids in the regulation of…

Q: Determine the sequence of a polypeptide treated with trypsin and chimotripsine. Below are the…

A: The sequence are:

Concept explainers

Nutrient Growth Medium

It is a culture medium or nutrient broth for all kinds of microorganisms to grow properly and create their colony. This matrix provides support to increase the population of microbes through the method of cell proliferation. It is regarded as the food material for those organisms. It is a type of in vitro mechanism, in which the development of life is processed outside the host body. It can be solid, semi-solid, or liquid in nature. Different kinds of cells develop in different types of media.

Question

In a mixed heteropolymer experiment, messages were created
with either 4/5C:1/5A or 4/5A:1/5C. These messages yielded proteins
with the amino acid compositions shown in the following
table. Using these data, predict the most specific coding composition
for each amino acid.
4/5C:1/5A 4/5A:1/5C
Pro 63.0% Pro 3.5%
His 13.0% His 3.0%
Thr 16.0% Thr 16.6%
Glu 3.0% Glu 13.0%
Asp 3.0% Asp 13.0%
Lys 0.5% Lys 50.0%
98.5% 99.1%

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Analysis of a 49kDA protein is aimed with a western blot technique. For this purpose, "whole cell extract" was obtained from biopsy samples taken from three different individuals, and when their spectrophotometric measurements were made, their concentrations were determined to be 40 µg/µL, 50 µg/µL, and 100 µg/µL for three samples, respectively. At the beginning of the experiment, 200 µg of protein is loaded into each gel well by using a ready 5x loading solution containing SDS and β-mercapta-ethanol together with glycerol and methylene blue dye. a) If loading will be done in a volume of 20µL, then how is the preparation of the samples before loading?b) Considering the loading content given above, what can be said about whether this PAGE is "non-denaturing" or "denaturing". Justify taking into account the loading solution content.
The concentration of RNase that Christian Anfinsen used in his denaturation/renaturation experiments was about 1 mg/ml. Inside the cell, the protein concentration is estimated to be more than 100 mg/ml. Predict the outcome of Anfinsen's experiments had he used a 100 mg/ml RNase concentration.
Identify the following mutations and describe what the possible effect on the protein will be. (4) 5’GAT TTT AGC TTA GCC CAT 3’ 5’ GAT TAG CTT AGC CCA T 3’ 3’CTA AAA TCG AAT CGG GTA 5’ 3’ CTA ATC GAA TCG GGT A 5’ 5’ GAT TTT AGC TTA CCC CAT 3’ 5’ GAT TTT AGC TAA CCC CAT 3’ 3’ CTA AAA TCG AAT GGG GTA 5’ 3’ CTA AAA TCG ATT GGG GTA 5’
1a) In MALDI-TOF data, when performing peptide mass mapping search, the peptide masses and the coverage remain the same, but the protien score increases, explain b) When the mass tolerance is decreased to ±0.05 Da. There are 11 peptide masses matched and the sequence coverage is 47%. The protein score increases to 191. However when the mass tolerance is decreased to ±0.01 Da. There are 3 peptide masses matched and the sequence coverage is 7%. The protein score decreases to 24. Explain.
A bioactive linear peptide was detected in amphibian toxıns. The peptide was found to be made up of 10 amino acids only, 2 of which are cysteines, 2 are arg, while the rest are either nonpolar or polar uncharged amino acids; no aromatic residues were also detected by amino acid analysis. The bioassay-guided isolation required the monitoring of the relative concentrations of proteins present. Which of the following quantitative and qualitative protein analysis will give a negative result? A. Lowry method B. Bradford method O C. Ultraviolet D. Bicinchoninic method E. Biuret
A classic way to isolate thymidylate synthase–negative mutants of bacteriais to treat a growing culture with thymidine and trimethoprim. Most ofthe cells are killed, and the survivors are greatly enriched in thymidylatesynthase–negative mutants.(a) What phenotype would allow you to identify these mutants?(b) What is the biochemical rationale for the selection? (That is, why are themutants not killed under these conditions?)(c) How would the procedure need to be modified to select mammalian cellmutants defective in thymidylate synthase?
Mabelle used the pET vector system to express her prokaryotic amylase enzyme. She added IPTG into her culture broth of DH5a Escherichia coli strain. At the end of the experiment, she discovered that her protein was not expressed. She repeated three more times but her protein of interest was still not produced. (i) (ii) Explain the reason why Mabelle failed to obtain her protein of interest and suggest a solution to troubleshoot this problem. Mabelle plans to express her protein fused to a polyhistidine-tag (His-tag). Explain the importance of His-tag in protein work.
b. Compounds A, B, C, and D are known to be intermediates in the pathway for production of protein E. To determine where the block in protein-E production occurred in each individual, the various intermediates were given to each individuals cel Is in culture. After a few weeks of growth with the intermediate, the cells were assayed for the production of protein E. The results for each individuals cells are given in the following table. A plus sign means that protein E was produced after the cells were given the intermediate listed at the top of the column. A minus sign means that the cells still could not produce protein E even after being exposed to the intermediate at the top of the column. Denote the point in the pathway in which each individual is blocked.
a. Compounds A, B, C, and D are known to be intermediates in the pathway for production of protein E. To determine where the block in protein-E production occurred in each individual, the various intermediates were given to each individuals cel Is in culture. After a few weeks of growth with the intermediate, the cells were assayed for the production of protein E. The results for each individuals cells are given in the following table. A plus sign means that protein E was produced after the cells were given the intermediate listed at the top of the column. A minus sign means that the cells still could not produce protein E even after being exposed to the intermediate at the top of the column. Draw the pathway leading to the production of protein E.
A classic way to isolate thymidylate synthase-negative mutants of bacteria is to treat a growing culture with thymidine and trimetho- prim. Most of the cells are killed, and the survivors are greatly enriched in thymidylate synthase-negative mutants. (a) What phenotype would allow you to identify these mutants? (b) What is the biochemical rationale for the selection? (That is, why are the mutants not killed under these conditions?) (c) How would the procedure need to be modified to select mam- malian cell mutants defective in thymidylate synthase?
How do you seal sequence 2 (from 5' end) to the 3' end of the sequence 1 in vitro condition? Design a splint oligomer and write the all-possible content(s) needed for reaction to occur. Sequence 1: 5'ACTGTCGATGCTAGCTTGATCCAAGTATTGCTAGACAGAATTGACATATAGGCGATGCTAGT3' Sequence 2: 5'ATCGCTAGGATCGCTAGATTTAAGTCGCTGATCGGCTAGATATAACAGGTCCTGAATCGCTA3'
A bloactlve hexapeptide was cleaved by trypsln from a larger proteln. The peptlde was sequenced by treatment with varlOus reagents and enzymes. The results are as follows: a) Treatment with cyan0gen bromlde gave a tetrapeptlde of compositlon asp, trp, cys and met. b) Treatment with chymotrypsln gave a tripeptlde of compositlon asp, trp and cys, a dipeptlde wlth the same C-term and an amlno acld. c) Treatment with streptococcal protease gave a dipeptlde and a tetrapeptlde. The composltion of the peptlde Is lys, trp, asp, cys and met 1. What Is the sequence of the hexapeptlde? 2. What is the pl of thls peptlde?