iii. Mutant C has had the first 5 base pairs deleted (position 1-5). Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene?
Q: At which level of gene regulation shown in Figure 16.1 does attenuation occur?
A: Attenuation is a process which involves a presence of a stop signal which suggests premature…
Q: 1. What is the effect of RNAI on gene expression? A. Knock out B. Knock down C. Knock up D. Knock in
A: RNAi means RNA interference which is a biological process in which miRNA / siRNA neutralizes the…
Q: 1. Bioinformatics analyses of the genomes of cancer cells from many different patients with…
A: Introduction Cancer is a disease in which some cells in the body grow out of control and spread to…
Q: In gene therapy an attempt is made to transfer a "normal" gene into the cells of a person who lacks…
A: Although gene therapy is a newer concept that has yet to be completely investigated, it has been…
Q: Mutant C has had the first 5 base pairs deleted (position 1-5). Does this mutation change the…
A: Translation is the process which is responsible for synthesis of protein from the mRNA.
Q: 4) The p53 protein normally involves a) DNA repair b) Cell cycle arrest c) Apoptosis d) All of the…
A: p53 is a gene that codes for a protein P53.
Q: Translational control of gene expression occurs within thea. nucleus.b. cytoplasm.c. nucleolus.d.…
A: A gene is the fundamental biology unit just like the atom. Gene expression is the process by which…
Q: b) Use the DNA sequence below to answer the following questions. 3'- TACGAACGAGTGCCCCAAAATT -5' What…
A: The process of converting DNA instructions into proteins is known as the central Dogma.
Q: . Why doesn't having a gene variant associated with a particular illness or disorder guarantee a…
A: Genes are DNA structures found in chromosomes. The structure of our genes governs how our bodies…
Q: 1. Since 1978, scientists used a specific biotechnology to produce a medicine used to treat…
A: Technology used: Recombinanant DNA. technology. The technology used to make DNA from…
Q: which of the following statements is correct? A proteins make MRNA which then makes genes B genes…
A: Protein synthesis is the essential metabolism occurring in all livings; proteins are made from…
Q: The role of p53 in normal cells is toa. create cancer-blocking mutations.b. trigger unrestrained…
A: Answer- P53 is the tumor supressing gene that is prensent in every cell. Any mutation in this leads…
Q: Post-translational modifications of proteins can affect which of the following? a. protein function…
A: When RNA has been transported to the cytoplasm, it is being translated into protein whose control is…
Q: Explain point mutations and frameshift mutations. Which is more apt to disrupt the structure and…
A: Proteins are the expression of the information present in the DNA (deoxyribonucleic acid). This…
Q: A mutation within the promoter region can alter transcription of a gene. Describe how this can…
A: 30. A mutation within the promoter region can alter transcription of a gene. Describe how this can…
Q: Which of the following statament is NOT TRUE about gene expression? a. The expression of genes that…
A: Gene expression is the process where cell uses to produce the molecule it needs by reading the…
Q: b. The process by which the DNA instructions are converted into the functional product is called…
A: DNA m-RNA A U G C G C T A T A A U C G T A G C
Q: erm BEST describes the process of increasing mRNA production for a gene in response to a stimulus
A: The biological process by which the information encoded inside a DNA (deoxyribonucleic acid)…
Q: 2. A single human body cell typically contains thousands of structures that contain information. How…
A: A single human body cell typically contains thousand of structure that contain information. How…
Q: 3. Figure on the right shows a DNA microarray assay of gene expression levels. In this microarray if…
A: Micro arrays are utilised for the determination of gene expression patterns in specific tissues or…
Q: In what mechanisms can genetic information be altered? What are the consequences of these changes?
A: Alteration or changes in genetic information is called mutation. Mutation can be spontaneous or it…
Q: How does reverse methylation affect gene expression? Select one: o a. The gene is turned off, but…
A: Hello. Since your question has multiple parts, we will solve first question for you. If you want…
Q: Expression of a gene, in terms of greater accumulation of the protein it encodes, could be increased…
A: Often biomolecules like protein are produced in our body for any bodily functions. They are specific…
Q: a. b. What constitutes the protein-coding region of a mature mRNA molecule?
A: INTRODUCTION The process of copying a segment of DNA into mRNA known as transcription. In the DNA…
Q: 2) Briefly describe 6 different ways that eukaryotic cells typically regulate Gene Expression
A: Gene expression is the process by which a particular or a set of genes are expressed with the help…
Q: 1. Let's review! The central dogma of molecular biology refers to the process of gene expression.…
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…
Q: 2. Muscular dystrophy is a genetic disorder that causes progressive muscle weakness as individual…
A: Muscular dystrophy It is a genetic disorder, in this disease the muscle of the individual weakens.…
Q: 5. discuss different components and types of epigenetic gene regulation 6. define mutation and…
A: Mutation occurs when the base pair sequence of our DNA changes as a result of numerous environmental…
Q: 1. A neuron and a white cell have very different functions. For example, a neuron can receive and…
A: Hello, thank you for your question. Our policy is to answer one question at a time, I am answering…
Q: B. What is different about the way in which these two DNA sequences increase the rate of…
A: The Catabolite activator protein (CAP) in E.coli activates transcription at more than a hundred…
Q: 1. Nutritional Genomics is the term used to describe: a. How nutrients affect gene expression b. How…
A: Nutrigenetics is a newly developing field where the "we are what we eat" idiom will get an entirely…
Q: 6. The starting scquence of a gene changed from AUGTTCGACGTG, to AUGTTTTCGACGTG What type of…
A: 1)Question asked: What the mutation is ? Answer: The type of mutation present in the given example…
Q: 4. Write a short paragraph on mutations and how they may alter protein synthesis and function.
A: Introduction :- A mutation is a change in the genetic material in biology. This refers to changes in…
Q: 1. What is RNA? And, how is RNA modified? 2. What are the 3 major steps involved in mRNA…
A: Ribonucleic acid is a molecule similar to DNA. Unlike DNA, RNA is single-stranded.
Q: 3.) How do cis-acting regulatory elements and trans-acting regulatory proteins act in coordination…
A: A trans-acting element is usually a DNA sequence that contains a gene. This gene encodes for a…
Q: d. Where would you find a mutation that affects transcription of this gene? e. Where would you find…
A: A human gene at molecular level consists of several parts like promoter where the transcription…
Q: Vhich statement about DNA methylation is true? D It requires a histone methylase. D It involves the…
A: DNA methylation is a process in which methyl groups are attached to different bases of DNA with the…
Q: 1. How is PKD inherited? What gene is responsible for the expression of PK enzyme ?
A: Pyruvate kinase deficiency is an inherited lack of the pyruvate kinase, that gets used by red blood…
Q: ce between prokaryotes and eukaryotes gene expression c) state the importance of regulating gene…
A: Genes Genes are defined as nucleotide sequences on the DNA or RNA that specifies a functional…
Q: 5. How the modification and histone interaction with DNA brought to transcriptional silencing. Use…
A: Yeast Saccharomyces cerevisiae (single-celled fungus microorganisms). Since ancient times, the…
Q: 5. A new mutation that arose in one copy of gene X in a somatic cell resulted in the formation of a…
A: Mutation is change that occurs in our DNA sequence, either due to mistakes when DNA is copied or the…
Q: 1. Define gene expression. 2. Why must gene expression be regulated?
A: Gene expression is basically the expression of phenotype in an organism, using the information of…
Q: 2. įmagine that you and your colleagues are working in a lab to develop a protein synthesis system…
A: The prokaryotes have a polycistronic mRNA while the eukaryotes have a monocistronic mRNA. The mRNA…
Q: (2) Design an experiment on how would molecular genetic tools, such as DNA microarrays, be used to…
A: DNA microarray is a molecular technique used to compare the expression of many genes simultaneously.…
Q: True or Flase: Cells must only divide when they receive a signal to divide. 2. BRCA1 is a gene that…
A: All cell must have to go through cell cycle. Cell division requires two major events interphase and…
Q: Gene expression does not vary by_______ . a. cell type c. stage of development b. extracellular…
A: Gene expression is defined as the process wherein genes are read/translated using process-specific…
Q: 14. Complete the following table, which compares late-stage gene regulation mechanisms.
A: The 'Central Dogma' is a process of converting DNA information to RNA, which results in a protein,…
Step by step
Solved in 2 steps
- 4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 5'...TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...3' 3' ...AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...5' * promotere. You also study the expression of 2 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? o If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 5'..TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...3’ 3' ...AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...5' promoter i. Mutant A has a single base pair substitution with the T/A being replaced with C/G base pair at position 35 (position denoted by the * in the sequence above).e. You also study the expression of a different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 5'...TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC..3' 3' ...AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...5' promoter
- Bong Question #1: The diagram below depicts the regulatory regions for two (made-up) genes, which contain cis-regulatory sequences X, Y, and Z and bind to transcriptional regulatory proteins: zelo led diogot bolgate SMARTY – a transcriptional ACTIVATOR protein, which is present in all neuronal cells and binds to cis-regulatory sequence, X1oq & vino 19vewod.152 moldong sai mut tum BRAWNY-a transcriptional ACTIVATOR protein, which is present in all muscle cells and binds to cis-resgulatory sequence, Yolgulum di ko malo na SNARKY - a transcriptional REPRESSOR protein, which is present in peripheral neurons only and binds to cis-regulatory sequence Z 100 bio se i da se lotimo broup gniwollt od 19 bolgate ons zegg or we de base do no me to stir noitesup od went of sistemos seu anoitesup 15wens horle 10oldog woy ni gnius stoted 1910 ni tatayot ovizasovo got no rade od lliw anioq azia oo ingene Aroom or b X y Jeol VELY gan 100 Tonnodige ΤΑΤΑ, 229nibrow dong H .aodto diw atse meldong mov.no o…I. The retinoic acid receptor (RAR) is a transcription factor that is similar to steroid hormone receptors. Thesubstance (ligand) that binds to this receptor is retinoicacid. One of the genes whose transcription is activatedby retinoic acid binding to the receptor is myoD. Thediagram that follows shows a schematic view of theRAR proteins produced by genes into which one oftwo different 12-base double-stranded oligonucleotides had been inserted in the ORF. The insertion site(a–m) associated with each mutant protein is indicatedwith the appropriate letter on the polypeptide map.For constructs encoding proteins a–e, oligonucleotide 1(5′ TTAATTAATTAA 3′ read off either strand) wasinserted into the RAR gene. For constructs encoding proteins f–m, oligonucleotide 2 (5′ CCGGCCGGCCGG 3′)was inserted into the gene.NH2 f g h i j k l m COOHa b c d eThe wild-type RAR protein can both bind DNA and activate transcription weakly in the absence of retinoic acid(RA) and strongly in RA’s presence. Each…Wilms tumor 1, or nephroblastoma, is caused by mutations in the WT1 gene, which encodes a transcription factor. You have identified a novel variant in WT1: Arg422Pro. You have control cells and cells that have been engineered to carry the homozygous WT1 p.Arg422Pro mutation. You want to assess effects of this mutation on a variety of endpoints. For each endpoint listed below, choose the one technique is best suited to answer the question. Choose from: array CGH, qRT-PCR, qPCR, RNA-seq, FISH, in situ hybridization, western blot, immunostaining, WT1 ChIP-seq, WT1 ChIP-PCR, ATAC-seq, 3C Endpoint Technique? WT1 protein amount (quantitative) Western blot WT1 protein binding to all enhancers, genome-wide Chip-seq WT1 mRNA amount (quantitative) WT1 protein subcellular localization Quantitative assessment of all mRNAs in these cells (genome-wide) RNAseq Chromatin interactions between a specific WT1 chromatin binding site (identified above)…
- Original DNA Sequence: TACAC CTTGG CGACGACT... MRNA Sequence: Amino Acid Sequence: Mutated DNA Sequence #5 TACACCTT G G GACGACT... (Highlight the change) What's the mRNA sequence? What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? 1. Which type of mutation is responsible for new variations of a trait? 2. Which type of mutation does not result in an abnormal amino acid sequence? 3. Which type of mutation stops the translation of an mRNA molecule? NO6 of 22 All cells in a given mammal carry the same genome, yet certain genes are expressed only in a particular tissue, such as in the eye, and not expressed in other tissues, such as in the liver. How is this specificity of gene expression for a particular tissue achieved? O All different cell types in the organism express all proteins equally and degrade the proteins that they don't need. O Different tissues express unique transcription factors that are bound to tissue-specific enhancer elements, thereby achieving tissue-specific gene expression. O Certain organ and tissue systems, such as the nervous system, form relatively early in the organism's embryonic life, as compared to the epidermis; it is this relative age of the tissue lineage that determines which tissue- specific genes are expressed. O Different tissues inactivate whole swaths of the genome, thereby achieving tissue-specific gene expression. O Each tissue has a unique RNA polymerase holoenzyme that achieves…G-LO37 Identify the consequences of mutations in different regions of a gene. The image below represents two strands of DNA: the top one corresponds to a healthy individual, and the bottom one of a sibling potentially affected with a disease due to genetic mutations Mutation 1 A + с AUA ACA AUG Met ACG GUU GUC GUA GUG Val GCU GCC GCA GCG It will result in mRNA produced Mutation 2 It will result in no mRNA produced 500 AGG The protein produced will be normal 500 + GGG Ala The Select all that applies about Mutation 1 (position -6): AAGLys AGA Arg GGU GGC GGA GGG GAC Asp GAA Glu GAGJ Gly The protein produced will have a different amino acid 1235 ATT 1235 TTT 070 2070 ALL The mutation occurs in the promoter region, and this means that the mRNA cannot be produced 1535 The mRNA and protein will both be normal because the mutation occurs outside of the consensus region of the promoter G 1535 с Affected
- You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAA! AAGCTCGAGAGCAGCAGCTСТАTGCGCTAСТАТААТGACСАТТАТАССССТАСGTGATAG 3' СTGGIAATATOGGGATGCACTАТС 5' RNA promoter polymerase Practice Question 4 F) You also study the expression of different mutants for this gene. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above). For mutant B answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 3'...TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...5' 5'..AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...3' promoter m in…e B 1_30*_SP23 - General Biology I (for majors)/11364 of € 2 A us page X F1 What conditions would we find on the gene of a prokaryote if there is low amounts of tryptophan within the cytoplasm? Select one: a. lactose would attach to the repressor removing it from the promoter promoting the transcription of lactase b. no repressor is on the promoter creating constant transcription of lactase c. tryptophan would attach to the repressor removing it from the promoter promoting the transcription of lactase O d. repressors would bind to the promoter stopping the transcription of lactase e. lactose would attach to the repressor removing it from the promoter promoting the transcription of tryptophan producing enzymes no repressor is on the promoter creating constant transcription of tryptophan producing enzymes tryptophan would attach to the repressor binding it to the promoter and stopping the transcription of tryptophan producing enzymes O f. O g. 2 Oh. tryptophan would attach to the…You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 AGATACGCGATGATATTACTGCTA AAGCTCGAGAGCAGCAGCTCТАTGCGCTACТАТААТGACCАТТАТАССССТАCGTGATAG 3' TТCGAGCTCTСGTCGTCGAGA ПААТАТСGGGATGCАСТАТ С 5' RNA promoter polymerase Practice Question 4 G) You also study the expression of different mutants for this gene. Mutant C has had the first 5 base pairs deleted (position 1-5). Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? For mutant C answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any)…